† These authors contributed equally.
Balanced skin microbiota is crucial for maintaining healthy normal skin
function; however, disruption of the balance in skin microbiota is linked with
skin diseases such as atopic dermatitis, acne vulgaris, dandruff, and
candidiasis. Lactoplantibacillus species with proved with health
benefits are probiotics that improve the balance of microbiome in skin and gut.
In the present study, we investigated the potential antimicrobial activity of
Lactiplantibacillus plantarum APsulloc 331261 (APsulloc 331261) and
Lactiplantibacillus plantarum APsulloc 331266 (APsulloc 331266) derived
from green tea, in inhibiting five skin pathogenic strains
(Staphylococcus aureus (S. aureus), Cutibacterium acnes
(C. acnes), Candia albicans (C. albicans), Malassezia
globosa (M. globose), and Malassezia restricta (M. restricta))
associated with skin infection. Viability of
S. aureus, C. acnes, C. albicans, M. globosa, and M. restricta was inhibited by indirect co-culture with APsulloc 331261 or APsulloc
331266 at various ratios. Different concentrations of the cell-free conditioned
media (CM) derived from APsulloc 331261 or APsulloc 331266 inhibited the
vaibility of S. aureus, C. acnes, C. albicans, M. globosa
and M. restricta in a dose dependent manner. Moreover, susceptibility
of S. aureus, C. acnes, and C. albicans against APsulloc 331261
or APsulloc 331266 was confirmed following agar overlay methods. Results of the
agar overlay confirmed that various concentrations of APsulloc 331261 and
APsulloc 331266 exhibited low to high inhibitory activity on the growth of
S. aureus (ZDI 20.3
Probiotics are defined as living organisms that provide a health benefit on the host when administered in adequate amounts [1]. Probiotics are gaining immense attention in scientific research, suggesting potential health benefits to host organism [2, 3]. Lactic acid bacteria (LAB) are the main bacteria that produce lactic acid as a major fermentation product using carbohydrate, and Lactoplantibacillus (formerly Lactobacillus) [4] species abundantly being presented in the intestines of vertebrates form the major part of this group [5]. Lactiplantibacillus plantarum (L. plantarum) with proved health benefit based on well-designed clinical studies are used probiotics in the food and nutraceutical industries [6, 7]. L. plantarum are known to produce various antimicrobial compounds such as bacteriocin, hydrogen peroxide, and acids [8]. Bacteriocins are ribosomally synthesized antimicrobial peptides that inhibit or kill the bacterial strains closely related or non-related to produced bacteria without causing any harm to bacteria themselves owing to the presence of self-defensive proteins [9, 10].
The skin possesses diverse microbiome, which provides protection against invading pathogens by the production of protein complex antibiotics [11, 12]. Change in the homeostasis between the host and microorganism is associated with skin diseases or infections [12]. A variety of key microbial genera are associated with skin health, including bacterial species Staphylococcus and Cutibacterium (formerly Propionibacterium), and fungal species Candida and Malassezia. Staphylococcus aureus (S. aureus) is a gram-positive and facultative anaerobic bacteria [13]. The colonizationof S. aureus in the skin have an important role in the pathogenesis of atopic dermatitis (AD) by disrupting the epidermal barrier and contributing to flare and itching by inducing degranulation of mast cells [14]. Cutibacterium acnes (C. acnes), a gram-positive and aero-tolerant anaerobe bacterium, is the primary trigger for opportunistic infection, aggravating acne lesions [15]. The breakout of acne occurs in the sebaceous gland in the skin where increased sebum secretion promotes abnormal keratinisation, resulting in follicular clogging and proliferation of C. acnes. Subsequently, it induces inflammatory cytokine responses, leading to redness and oedema, and exacerbates acne symptoms [16, 17]. Candidiasis is fungal infection caused by Candida and occurs in the skin, fingernails, mucous membranes throughout the body. Candida is a part of fungal commensals in the human body; however, when the immune system of the body becomes compromised or the skin is broken, Candida can cause infections in the skin, fingernails, mucous membranes throughout the body [18, 19, 20]. Malassezia is a lipophilic fungal genus resident on normal skin and observed in approximately 75%–98% of healthy adults [21]. Malassezia generated free fatty acids, particularly lipase mediated breakdown of sebum triglycerides, can induce flaking in dandruff-susceptible patients [22].
Antibiotics administration to treat skin diseases may result in negative effects, such as dose-dependent toxicity, and the emergence of resistant pathogenic strains [21, 23, 24]. Infections caused by antibiotic resistant bacteria are serious threat to global health. The pathogens causing these infections can obtain the antibiotic resistance genes from proliferation of multi-drug-resistant bacteria, which, in turn, abrogate the effect of antibiotics due to persistence of the resistance genes in the microbiota [25]. Topical or oral administration of probiotics, such as Lactiplantibacillus species, could ameliorate skin health by inhibiting colonisation of skin pathogens and maintaining the balance of the gut flora [26, 27, 28]. Therefore, there is an urgent need to develop innovative strains of probiotics for alternative antimicrobial therapy against infectious diseases.
The safety and beneficial effect of Lactiplantibacillus plantarum APsulloc 331261 (APsulloc 331261) and Lactiplantibacillus plantarum APsulloc 331266 (APsulloc 331266) isolated from green tea (Camellia sinensis) have also been described [29]. APsulloc 331261 alleviates gastric inflammation, which might be attributed to the production of propionate derived from the modulation of gut microbiome in an alcohol-dependent gastric ulcer [30]. APsulloc 331261 significantly boosts the abundance of various intestinal beneficial bacteria such as Bifidobacterium spp. and Clostridium butyricum. Moreover, APsulloc 331261-derived extracellular vesicles exerts beneficial effects on human skin by inducing anti-inflammatory cytokine-mediated by M2 macrophage polarisation [31]. In the present study,we examined the antimicrobial activity of APsulloc 331261 and APsulloc 331266 against five skin pathogenic strains (S. aureus, C. acnes, C. albicans, M. globosa and M. restricta). To determine antimicrobial activity of APsulloc 331261 and APsulloc 331266, we validated the viability of five strains implicated in skin disease by indirect co-culture with APsulloc 331261 or APsulloc 331266, and cell-free conditioned media (CM)-derived from APsulloc 331261 or APsulloc 331266. Antimicrobial activity of APsulloc 331261 or APsulloc 331266 was further evaluated by plate agar overlay assay against three strains. Finally, the profile of PCR amplicon products for plantaricin genes in APsulloc 331261 and APsulloc 331266 were identified by standard PCR.
APsulloc 331261 (KCCM11179P) and APsulloc 331266 (KCCM11180P) isolated from
green tea derived from the leaves of Camellia sinensis (Osulloc farm,
Jeju island, South Korea) [29] were cultured in MRS broth at 37
Strain | ATCC no. |
Staphylococcus aureus | ATCC 6538 |
Cutibacterium acnes | ATCC 6919 |
Candida albicans | ATCC 90028 |
Malassezia globosa | MYA-4612 |
Malassezia restricta | MYA-4611 |
Five pathogenic strains (S. aureus, C. acnes, C. albicans, M.
globosa and M. restricta) were co-cultured in APsulloc 331261 or
APsulloc 331266 using a 6-well transwell chamber with a 0.4
To obtain the cell-free CM, overnight culture of APsulloc 331261 and APsulloc
331266 was sub- cultured to mid-to-late logarithmic phase and adjusted to
OD
The effects of APsulloc 331261 and APsulloc 331266 on the growth of S.
aureus, C. acnes, and C. albicans were examined on agar plates
as previously described [32]. For the plate agar overlay assays, 1, 2 and 4
Total DNA from APsulloc 331261 and APsulloc 331266 was extracted using a
G-spin™ Total DNA Extraction Mini Kit (iNtRON BIOTECHNOLOGY, Gyeonggi-do,
South Korea), following the manufacturer’s protocol. A set of primers (listed in
Table 2 [35]) used to amplify plantaricin genes was designed and PCR was
performed using a 2X TOPsimple™ PreMIX-nTaq (Enzynomics, Daejeon, South
Korea) and SimpliAmp Thermal Cycler (Applied Biosystems, Foster City, CA, USA),
as previously described [35]. The PCR conditions were as follows: initial
denaturation at 94
Target gene | Forward primer (5′ |
Reverse primer (5′ |
plnA | GTACAGTACTAATGGGAG | CTTACGCCATCTATACG |
plnH | TCTTACACGATCAAGGCAAC | TGTGCCATTACTTACCTGTTTC |
plnG | TGCGGTTATCAGTATGTCAAAG | CCTCGAAACAATTTCCCCC |
plnEF | GGCATAGTTAAAATTCCCCCC | CAGGTTGCCGCAAAAAAAG |
plnJ | TAACGACGGATTGCTCTG | AATCAAGGAATTATCACATTAGTC |
plnK | AATCGCAGTGACTTCCAGAAC | AGAGCAATCCGTCGTTAATAAATG |
plnS | GCCTTACCAGCGTAATGCCC | CTGGTGATGCAATCGTTAGTTT |
plnW | TCACACGAAATATTCCA | GGCAAGCGTAAGAAATAAATGAG |
plnN | ATTGCCGGGTTAGGTATCG | CCTAAACCATGCCATGCAC |
plnNC8 |
GGTCTGCGTATAAGCATCGC | AAATTGAACATATGGGTGCTTTAAATTCC |
The data of this study are presented as the mean
The antibacterial activity of APsulloc 331261 and APsulloc 331266 against S. aureus was examined by a viability assay with a transwell chamber. With APsulloc 331261 or APsulloc 331266 in the apical compartment and S. aureus in the basolateral compartment, they can interact via metabolites in their shared medium while being physically separated by a membrane. S. aureus was co-cultured with APsulloc 331261 or APsulloc 331266 in S. aureus to APsulloc 331261 or APsulloc 331266 ratios of 1:0.001, 1:0.01, 1:0.1, 1:1. These experiments revealed that S. aureus growth drastically decreased even in the ratio 1:0.001 of S. aureus to APsulloc 331261or APsulloc 331266 (Fig. 1A). APsulloc 331261 or APsulloc 331266 at ratio 1:0.001, 1:0.01, 1:0.1 and 1:1 reduced the growth of S. aureus by 86.6%, 88.9%, 90.0%, and 93.2%, respectively, or 86.8%, 89.7%, 89.7%, and 93.9%, respectively. We also tested the effect of various concentrations (2.5, 5, 10, 25 and 50%) of CM-derived from APsulloc 331261 or APsulloc 331266, which is cell-free supernatant containing soluble factors,on the growth of S. aureus. We found that the growth of S. aureus was suppressed by CM-derived from APsulloc 331261 or APsulloc 331266 in a dose-dependent manner (Fig. 1B). 50% of CM-derived from APsulloc 331261 and APsulloc 331266 completely inhibited S. aureus growth by 97.7% and 98.6%, respectively, and 2.5–25% CM-derived from APsulloc 331261 and APsulloc 331266 resulted in 21–31% and 21–29% growth inhibition, respectively. Therefore, APsulloc 331261 and APsulloc 331266 exhibit anti-bacterial activity against pathogenic S. aureus, which may be mediated by APsulloc 331261 and APsulloc 331266-derived metabolites.
Antibacterial effect of APsulloc 331261 or APsulloc
331266 against S. aureus. (A) S. aureus were co-cultured in
the presence or absence of APsulloc 331261 or APsulloc 331266 in the inserts of
transwells at APsulloc 331261 and APsulloc 331266 to S. aureus ratios of
0.001:1, 0.01:1, 0.1:1 and 1:1. (B) S. aureus were incubated in various
concentrations of CM (0, 5, 10, 25, and 50%) derived from APsulloc 331261 or
APsulloc 331266. After incubation at 37
Antimicrobial activity of APsulloc 331261 and APsulloc 331266 against S.
aureus was further examined by agar overlay assay. Various populations (1
To determine antibacterial activity of APsulloc 331261 and APsulloc 331266, the viability of C. acnes co-cultured with APsulloc 331261 or APsulloc 331266 in a transwell chamber was evaluated. C. acnes located in the basolateral compartment and APsulloc 331261 or APsulloc 331266 located in the apical compartment were co-cultured in C. acnes to APsulloc 331261 or APsulloc 331266 ratios of 1:0.001, 1:0.01, 1:0.1, 1:1. These experiments showed that C. acnes growth drastically suppressed by 98.4–99.4% even in the ratio 1:0.001 of APsulloc 331261 or APsulloc 331266 to C. acnes (Fig. 2A). Next, we tested various concentrations (5, 10, 25 and 50%) of CM-derived from APsulloc 331261 or APsulloc 331266 on the growth of C. acnes. CM-derived from APsulloc 331261 and APsulloc 331266 suppressed the C. acnes growth in a dose dependent manner (Fig. 2B). 50% and 25% of APsulloc 331261 or APsulloc 331266 caused significant reduction of C. acnes growth by 96.5% and 74.4%, respectively, or, 99.9% and 98.8%, respectively. Collectively, APsulloc 331261 and APsulloc 331266-derived soluble factors effectively inhibit the C. acnes growth.
Antibacterial activity of APsulloc 331261 and APsulloc
331266 against C. acnes. (A) Using anaerobe container systems, APsulloc
331261 or APsulloc 331266 was co-cultured with C. acnes at ratios of
0.001:1, 0.01:1, 0.1:1 and 1:1. (B) C. acnes were incubated in various
concentrations of CM (0, 5, 10, 25, and 50%). After anaerobic incubation at 37
Antimicrobial activity of APsulloc 331261 and APsulloc 331266 against C.
acnes was determined by agar overlay methods. We determined antimicrobial
activity of various concentrations (1
The viability of C. albicans co-cultured with APsulloc 331261 or APsulloc 331266 in a transwell chamber was evaluated. These experiments revealed that, C. albicans to APsulloc 331261 or APsulloc 331266 at ratio 1:0.001, 1:0.01, 1:0.1 and 1:1 decreased C. albicans growth by 0, 21.4, 44.1 and 68.2%, respectively, or by 20.6, 33.0, 44.6 and 65.1%, respectively (Fig. 3A). Next, we tested various concentrations (25, 50, 75 and 100%) of CM-derived from APsulloc 331261 or APsulloc 331266 on the vaibiity of C. albicans. The viability assays exhibited that the growth of C. albicans was suppressed by CM-derived from APsulloc 331261 or APsulloc 331266 in a dose-dependent manner. 100% and 75% of CM-derived from APsulloc 331261 or APsulloc 331266 caused significant reduction of C. albicans growth by 65.4% and 37.3%, respectively, or 75.8% and 61.9%, respectively (Fig. 3B). Collectively, APsulloc 331261 and APsulloc 331266 secreted metabolites effectively abolish the growth of pathogenic C. albicans.
Antifungal activity of APsulloc 331261 and APsulloc
331266 against C. albicans. (A) APsulloc 331261 or APsulloc 331266 was
co-cultured with C. albicans at ratios of 0.001:1, 0.01:1, 0.1:1 and
1:1. (B) C. albicans were incubated in various concentrations of CM (0,
25, 50, 75, and 100%). After incubation at 37
Agar overlay assay was conducted to determine the effect of APsulloc 331261 or
APsulloc 331266 on C. albicans growth. APsulloc 331261 or APsulloc
331266 spotted at 1
To examine antifungal activity, the viability of M. globosa and M. restricta co-cultured with APsulloc 331261 and APsulloc 331266 was evaluated in a transwell chamber. These experiments revealed that M. globosa and M. restricta growth was significantly decreased in the presence of APsulloc 331261 or APsulloc 331266 at ratio 1:0.1 and 1:1 (Fig. 4A,C). We also tested the effect of various concentrations (25, 50, 75 and 100%) of CM-derived from APsulloc 331261 or APsulloc 331266 on the viability of M. globosa and M. restricta. These experiments demonstrated that the viability of M. globosa and M. restricta was suppressed by CM obtained from APsulloc 331261 or APsulloc 331266 in a dose-dependent manner (Fig. 4B,D). APsulloc 331261 or APsulloc 331266 derived CM was effective in inhibition of M. globosa and M. restricta growth in a dose dependent manner and 100% of CM completely abolished the growth of M. globosa and M. restricta. Collectively, APsulloc 331261 and APsulloc 331266, and their CM was effective in the inhibition of M. globosa and M. restricta growth.
Antifungal effect of APsulloc 331261 and APsulloc 331266
against M. globosa and M. restricta. (A,C) APsulloc 331261 or
APsulloc 331266 was co-cultured with M. globosa or M. restricta
at ratios of 0.1:1 and 1:1. (B,D) M. globosa or M. restricta
were incubated in various concentrations of CM (0, 25, 50, 75, and 100%) After
incubation at 30
Plantaricin, a bacteroicin produced in L. plantarum, is known to have
an antimicrobial effect [36]. To determine whether APsulloc 331261 and APsulloc
331266 express plantaricin genes, we evaluated ten genes, which are present in
the pln locus and are responsible for the synthesis of plantaricins. PCR
analysis showed that plnA, plnH, plnG, plnEF,
plnJ, plnK, and plnN genes exist in APsulloc 331261
and APsulloc 331266, and that plnS, plnW, and
plnNC8
The usage of probiotics to promote gut and immune health has recently grown, and researchers are interested in the discovery of a variety of probiotic strains and mechanisms how probiotic microorganisms interact with the body [37]. Probiotics play an potential alternative to antibiotics in the treatment of inflammatory bowel disease (IBD) [38] as well as lower the incidence of several atopic conditions [39, 40]. Among the commercially available probiotic strains, LAB from various natural sources are being isolated and identified to explore new alternative probiotic strains [41]. Probiotic Lactoplantibacillus species can be considered to be candidates for alternatives to antibiotics since their various mechanisms of growth inhibition against pathogenic bacteria have been extensively documented [42, 43, 44]. Lactiplantibacillus species isolated from various sources have an excellent antibacterial spectrum against pathogenic bacteria [5, 45, 46]. The antagonistic activity of Lactiplantibacillus species has mostly been attributed to the production of lactic acid. The acidification of cytoplasm of cell by the undissociated lactic acid that passes through the bacterial membrane and dissociates inside the cell results in failure of proton motive forces [47]. Besides organic acids, hydrogen peroxides, bacteriocins, and short-chain fatty acids (such as acetic, propionic, and butyric acids) are antimicrobial compounds produced by Lactiplantibacillus species, and the compounds lead to the change of the gut redox potential and the restriction of the nutrient supply to the pathogens [48]. In particular, L. plantarum synthesize a variety of antimicrobial plantaricins to inhibit the growth of competing bacteria. Plantaricin A, which plnA is encoded, acts as an extracellular signal that induces transcription of pln genes as well as an antimicrobial peptides [49]. Even though plantaricin E, F, J and K, encoded by plnE, plnF, plnJ and plnK, respectively, have an anti-microbial effect individually, two peptides are at least 1000 times more effective when cognate peptides such as PlnE and PlnF, or, PlnJ and PlnK, are combined [50]. Moreover, antifungal activity of plantaricin peptides PlnE, -F, -J, and -K is presented against pathogenic yeast, Candida albicans [51]. Plantaricin EF and JK form holes in the membrane of the target cell and cause the death by electronical potential and pH gradient to collapse [52, 53]. However, plantaricin EF and JK have different receptor [54]. plnH and plnG is related to ABC transport, which secrete and process pre-plantaricin E, F, J, and K to reveal the antimicrobial activity [52]. Yolanda et al. [55] classified the L. plantarum strains into seven plantaritypes, depending on the presence of the bacteriocin gene and the type of regulatory system. Both APsulloc 331261 and APsulloc 331266 do not have plnNC8, but plnA does exist, suggesting that they belong to group 1 and 2 of plantaritypes and have common characteristics of plnABCD regulation systems. Thus, the presence of plantaricin genes plnA, plnH, plnG, plnEF, plnJ, plnK, and plnN in APsulloc 331261 and APsulloc 331266 might contribute to the antimicrobial activity of APsulloc 331261 and APsulloc 331266 against skin pathogens. However, we only identified plantaricin genes, not their expression or activity. For better understanding of the mechanism of antimicrobial activity of APsulloc 331261 and APsulloc 331266, further studies are needed to confirm the plantaricin expression/activity and their antimicrobial activity against skin pathogenic microbiota.
Probiotics and prebiotics have been widely considered for the treatment and prevention of infectious diseases because of the various mechanisms by sharing genes and metabolites, helping other microbiota, and directly interacting epithelial and immune cells [56]. In this regard, several studies have investigated the effects of probiotic and prebiotics use on microbiota of other parts of human body. Therefore, probiotics and prebiotics are promising in improving skin health by modulating the cutaneous microbiota [57]. The gastrointestinal microbiota can communicate with the skin through modulation of systemic immune responses and maintain skin homeostasis [58]. In fact, beneficial effects of probiotics following topical or oral administration have been reported in skin diseases, such as acne vulgaris [27, 59, 60], atopic dermatitis [61], candida vaginitis [62], and dandruff [63]. The use of probiotics in cosmetics or nutraceuticals have been recently expanded to rebalance the microbiome for skin by inhibiting the growth of harmful pathogens while promoting the colonization of beneficial bacteria among the resident microorganisms. Thus, topical application or ingestion of APsulloc 331261 and APsulloc 331266 could improve skin health by inhibiting skin pathogens, ameliorating intestinal beneficial bacteria [30] and inducing macrophage polarisation [31]. Although we should carefully draw conclusion obtained from in vitro studies, our results support the hypothesis that probiotic APsulloc 331261 and APsulloc 331266 may ameliorate microbial profile and homoeostasis in the skin. Further studies are guaranteed to investigate the effectiveness of APsulloc 331261 and APsulloc 331266 as novel antibiotics or alternative therapeutics for treating skin infection.
In summary, the present study demonstrated that APsulloc 331261 and APsulloc 331266 isolated from green tea (Camellia sinensis) exhibited the inhibitory activity against five skin pathogenic strains (S. aureus, C. acnes, C. albicans, M. globosa and M. restricta) related to skin diseases. Antimicrobial effect of APsulloc 331261 and APsulloc 331266 was validated by indirect co-culture assay, CM culture assay and agar overlay assay with five pathogenic strains. These results indicate that novel APsulloc 331261 and APsulloc 331266 could serve as a potential alternative to antibiotics against infectious diseases. Further studies are guaranteed to explore the effectiveness of APsulloc 331261 and APsulloc 331266 administrated by topically or orally as alternative therapeutics in combating skin infection.
MC, BJK and JN designed the research and wrote the paper. JN, JOL and SYK performed the experiments and statistical analyses. YK, EL, DC, JR and WK prepared figures. All authors analysed and interpreted the data, revised the manuscript, and approved the final draft.
Not applicable.
Thanks to all the peer reviewers for their opinions and suggestions.
This research was funded by the AMOREPACIFIC R&D center (R21S200001).
The authors declare no conflict of interest.
LAB, Lactic acid bacteria; L. plantarum, Lactiplantibacillus plantarum; APsulloc 331261, Lactiplantibacillus plantarum APsulloc 331261; APsulloc 331266, Lactiplantibacillus plantarum APsulloc 331266; S. aureus, Staphylococcus aureus; C. acnes, Cutibacterium acnes; C. albicans, Candida albicans; M. globosa, Malassezia globosa; M. restricta, Malassezia restricta; ATCC, American Type Culture Collection; CM, Cell-free conditioned media; TS, Tryptic soy; MRC, Modified reinforced Clostridium; YM, Yeast malt; MLNA, Modified Leeming & Notman agar; SD, Standard deviation; ZDI, Zone diameter of inhibition.