IMR Press / FBE / Volume 13 / Issue 2 / DOI: 10.52586/E881
Open Access Article
Antimicrobial activity of Lactiplantibacillus plantarum APsulloc 331261 and APsulloc 331266 against pathogenic skin microbiota
Show Less
1 AMOREPACIFIC R&D Center, AMOREPACIFIC, 17074 Yongin, Republic of Korea
2 Department of Dermatology, College of Medicine, Chung-Ang University, 06974 Seoul, Republic of Korea
3 Department of Medicine, Graduate School, Chung-Ang University, 06973 Seoul, Republic of Korea
4 Department of Life Science, Sogang University, 04107 Seoul, Republic of Korea

These authors contributed equally.

Front. Biosci. (Elite Ed) 2021 , 13(2), 237–248; https://doi.org/10.52586/E881
Submitted: 17 September 2021 | Revised: 19 October 2021 | Accepted: 15 November 2021 | Published: 20 December 2021
Copyright: © 2021 The Author(s). Published by BRI.
This is an open access article under the CC BY 4.0 license (https://creativecommons.org/licenses/by/4.0/).
Abstract

Balanced skin microbiota is crucial for maintaining healthy normal skin function; however, disruption of the balance in skin microbiota is linked with skin diseases such as atopic dermatitis, acne vulgaris, dandruff, and candidiasis. Lactoplantibacillus species with proved with health benefits are probiotics that improve the balance of microbiome in skin and gut. In the present study, we investigated the potential antimicrobial activity of Lactiplantibacillus plantarum APsulloc 331261 (APsulloc 331261) and Lactiplantibacillus plantarum APsulloc 331266 (APsulloc 331266) derived from green tea, in inhibiting five skin pathogenic strains (Staphylococcus aureus (S. aureus), Cutibacterium acnes (C. acnes), Candia albicans (C. albicans), Malassezia globosa (M. globose), and Malassezia restricta (M. restricta)) associated with skin infection. Viability of S. aureus, C. acnes, C. albicans, M. globosa, and M. restricta was inhibited by indirect co-culture with APsulloc 331261 or APsulloc 331266 at various ratios. Different concentrations of the cell-free conditioned media (CM) derived from APsulloc 331261 or APsulloc 331266 inhibited the vaibility of S. aureus, C. acnes, C. albicans, M. globosa and M. restricta in a dose dependent manner. Moreover, susceptibility of S. aureus, C. acnes, and C. albicans against APsulloc 331261 or APsulloc 331266 was confirmed following agar overlay methods. Results of the agar overlay confirmed that various concentrations of APsulloc 331261 and APsulloc 331266 exhibited low to high inhibitory activity on the growth of S. aureus (ZDI 20.3 ± 2.1–32.3 ± 2.1 mm, R value 5.7 ± 0.8–7.8 ± 1.3 mm), C. acnes (ZDI 15.0 ± 1.7–22.2 ± 1.7 mm, R value 3.2 ± 1.3–5.5 ± 1.3 mm) and C. albicans (ZDI 13.3 ± 4.0–27.0 ± 3.6 mm, R value 2.8 ± 1.9–5.5 ± 1.7 mm). Finally, standard PCR analysis identified the presence of the of plantaricin genes encoding antimicrobial peptides in APsulloc 331261 and APsulloc 331266. These results suggest that APsulloc 331261 and APsulloc 331266 has a potential effect in the improvement of the balance of skin microbiota by inhibiting skin pathogenic strains.

Keywords
Lactiplantibacillus plantarum
APsulloc
Green tea
Skin pathogens
Staphylococcus aureus
Cutibacterium acnes
Candia albicans
Malassezia globosa
Malassezia restricta
Plantaricin
2. Introduction

Probiotics are defined as living organisms that provide a health benefit on the host when administered in adequate amounts [1]. Probiotics are gaining immense attention in scientific research, suggesting potential health benefits to host organism [2,3]. Lactic acid bacteria (LAB) are the main bacteria that produce lactic acid as a major fermentation product using carbohydrate, and Lactoplantibacillus (formerly Lactobacillus) [4] species abundantly being presented in the intestines of vertebrates form the major part of this group [5]. Lactiplantibacillus plantarum (L. plantarum) with proved health benefit based on well-designed clinical studies are used probiotics in the food and nutraceutical industries [6,7]. L. plantarum are known to produce various antimicrobial compounds such as bacteriocin, hydrogen peroxide, and acids [8]. Bacteriocins are ribosomally synthesized antimicrobial peptides that inhibit or kill the bacterial strains closely related or non-related to produced bacteria without causing any harm to bacteria themselves owing to the presence of self-defensive proteins [9,10].

The skin possesses diverse microbiome, which provides protection against invading pathogens by the production of protein complex antibiotics [11,12]. Change in the homeostasis between the host and microorganism is associated with skin diseases or infections [12]. A variety of key microbial genera are associated with skin health, including bacterial species Staphylococcus and Cutibacterium (formerly Propionibacterium), and fungal species Candida and Malassezia. Staphylococcus aureus (S. aureus) is a gram-positive and facultative anaerobic bacteria [13]. The colonizationof S. aureus in the skin have an important role in the pathogenesis of atopic dermatitis (AD) by disrupting the epidermal barrier and contributing to flare and itching by inducing degranulation of mast cells [14]. Cutibacterium acnes (C. acnes), a gram-positive and aero-tolerant anaerobe bacterium, is the primary trigger for opportunistic infection, aggravating acne lesions [15]. The breakout of acne occurs in the sebaceous gland in the skin where increased sebum secretion promotes abnormal keratinisation, resulting in follicular clogging and proliferation of C. acnes. Subsequently, it induces inflammatory cytokine responses, leading to redness and oedema, and exacerbates acne symptoms [16,17]. Candidiasis is fungal infection caused by Candida and occurs in the skin, fingernails, mucous membranes throughout the body. Candida is a part of fungal commensals in the human body; however, when the immune system of the body becomes compromised or the skin is broken, Candida can cause infections in the skin, fingernails, mucous membranes throughout the body [18-20]. Malassezia is a lipophilic fungal genus resident on normal skin and observed in approximately 75%–98% of healthy adults [21]. Malassezia generated free fatty acids, particularly lipase mediated breakdown of sebum triglycerides, can induce flaking in dandruff-susceptible patients [22].

Antibiotics administration to treat skin diseases may result in negative effects, such as dose-dependent toxicity, and the emergence of resistant pathogenic strains [21,23,24]. Infections caused by antibiotic resistant bacteria are serious threat to global health. The pathogens causing these infections can obtain the antibiotic resistance genes from proliferation of multi-drug-resistant bacteria, which, in turn, abrogate the effect of antibiotics due to persistence of the resistance genes in the microbiota [25]. Topical or oral administration of probiotics, such as Lactiplantibacillus species, could ameliorate skin health by inhibiting colonisation of skin pathogens and maintaining the balance of the gut flora [26-28]. Therefore, there is an urgent need to develop innovative strains of probiotics for alternative antimicrobial therapy against infectious diseases.

The safety and beneficial effect of Lactiplantibacillus plantarum APsulloc 331261 (APsulloc 331261) and Lactiplantibacillus plantarum APsulloc 331266 (APsulloc 331266) isolated from green tea (Camellia sinensis) have also been described [29]. APsulloc 331261 alleviates gastric inflammation, which might be attributed to the production of propionate derived from the modulation of gut microbiome in an alcohol-dependent gastric ulcer [30]. APsulloc 331261 significantly boosts the abundance of various intestinal beneficial bacteria such as Bifidobacterium spp. and Clostridium butyricum. Moreover, APsulloc 331261-derived extracellular vesicles exerts beneficial effects on human skin by inducing anti-inflammatory cytokine-mediated by M2 macrophage polarisation [31]. In the present study,we examined the antimicrobial activity of APsulloc 331261 and APsulloc 331266 against five skin pathogenic strains (S. aureus,C. acnes, C. albicans, M. globosa and M. restricta). To determine antimicrobial activity of APsulloc 331261 and APsulloc 331266, we validated the viability of five strains implicated in skin disease by indirect co-culture with APsulloc 331261 or APsulloc 331266, and cell-free conditioned media (CM)-derived from APsulloc 331261 or APsulloc 331266. Antimicrobial activity of APsulloc 331261 or APsulloc 331266 was further evaluated by plate agar overlay assay against three strains. Finally, the profile of PCR amplicon products for plantaricin genes in APsulloc 331261 and APsulloc 331266 were identified by standard PCR.

3. Materials and methods
3.1 Bacteria and fungi strains, and culture conditions

APsulloc 331261 (KCCM11179P) and APsulloc 331266 (KCCM11180P) isolated from green tea derived from the leaves of Camellia sinensis (Osulloc farm, Jeju island, South Korea) [29] were cultured in MRS broth at 37 C for 24 h (Becton, Dickinson and Company, Sparks, MD, USA). The bacterial and fungal strains were purchased from the American Type Culture Collection (ATCC, Rockville, MD, USA) (listed in Table 1) and cultured according to ATCC instructions. S. aureus and C. albicans were cultured in tryptic soy (TS) broth (Becton, Dickinson and Company) and yeast malt (YM) broth (Becton, Dickinson and Company), respectively, at 37 C, on a shaking incubator, for 24 h. M. globosa and M. restricta were cultured in modified Leeming & Notman agar (MLNA; ATCC medium 2737) without agar on a shaking incubator at 30 C for 72 h. C. acnes was cultured in modified reinforced Clostridium (MRC) medium (ATCC medium 2107) at 37 C for 72 h under anaerobic conditions. The cultures were diluted 1:50 or 1:100 in the indicated media, sub- cultured to mid-to-late logarithmic phase and adjusted to an OD600 of 0.5 before use.

Table 1.Bacterial and fungal strains used in the present study.
Strain ATCC no.
Staphylococcus aureus ATCC 6538
Cutibacterium acnes ATCC 6919
Candida albicans ATCC 90028
Malassezia globosa MYA-4612
Malassezia restricta MYA-4611
3.2 Indirect co-culture assay

Five pathogenic strains (S. aureus,C. acnes, C. albicans, M. globosa and M. restricta) were co-cultured in APsulloc 331261 or APsulloc 331266 using a 6-well transwell chamber with a 0.4 μm porous membrane (Co-star, Corning, NY, USA) [32,33]. The total volume of a well was consisted of 5 mL broth. 0.2% (v/v) of the pathogens (OD600 of 0.5) was placed in the basolateral compartment of transwell. S. aureus and C. albicans were incubated with MRS broth at 37 C for 48. C. acnes was incubated in MRC broth at 37 C for 96 h using BD GasPak™ EZ container systems (Becton, Dickinson and Company). M. globosa and M. restricta were incubated with MLNA medium without agar at 30 C for 72 h. Various ratios (v/v) of the pathogens to APsulloc 331261 and APsulloc 331266 (1:0.001, 1:0.01, 1:0.1 and 1:1) were inoculated in the insert with the indicated media used for incubation of pathogens to determine antimicrobial activity. The pathogenic culture without inoculation of APsulloc 331261 and APsulloc 331266 was used as control. After incubation, the viability of the pathogens was measured at OD600 using a microplate reader (SpectraMax i3x, Molecular Devices, San Jose, CA, USA).

3.3 Cell culture with CM assay

To obtain the cell-free CM, overnight culture of APsulloc 331261 and APsulloc 331266 was sub- cultured to mid-to-late logarithmic phase and adjusted to OD600 of 1.0. APsulloc 331261 or APsulloc 331266-derived supernatant was obtained after two centrifugation steps at 15000 ×g for 10 min. Supernatants were sterilized using 0.45 μm and 0.2 μm syringe filters (Whatman™, Maidstone, UK) and stored at –20 C. Prepared CM (100%) was diluted to various concentrations (75%, 50%, 25%, 10% and 5%, (v/v)) with MRS broth and incubated with 0.2% (v/v) of five pathogenic strains in 6 well plates at 37 C for 48 h, except on C. acnes for 96 h. The viability of the pathogens was measured at OD600 using a microplate reader.

3.4 Plate agar overlay assay

The effects of APsulloc 331261 and APsulloc 331266 on the growth of S. aureus,C. acnes, and C. albicans were examined on agar plates as previously described [32]. For the plate agar overlay assays, 1, 2 and 4 μL of APsulloc 331261 and APsulloc 331266 adjusted to an OD600 of 0.5 (ca. 1 × 104, 2 × 104, and 4 × 104 colony forming unit (CFU)) were spotted on 1.5% MRS agar plates and incubated for 48 h at 37 C. After cooling to 40 C in an autoclaved agar medium, S. aureus, C. acnes, and C. albicans suspension in 0.7% soft agar (TS, MRC, YM, respectively) were prepared and overlaid on the plates incubated with APsulloc 331261 and APsulloc 331266. After the plates were incubated at 37 C for 24 h under aerobic (S. aureus, C. albicans) or anaerobic (C. acnes) incubators, the zone of diameter inhibition (ZDI) value was determined following the method adopted by Shokryazdan et al. [34] (ZDI <10 mm, weak inhibition; ZDI 10–20 mm, intermediate inhibition; ZDI >20 mm, strong inhibition). Moreover, ‘R’ (width of clear zone) values were measured and interpreted, following the method devised by Kohler et al. [32] as follows: R = (dInhibition– dSpot)/2 (where ‘dInhibition’ is the diameter of clear zone around ‘dSpot’ and ‘dSpot’ refers to the diameter of the Lactiplantibacillus spot grown over the MRS agar plate; R <2 mm, no inhibition; R = 2–5 mm, low inhibition; R >6 mm, high inhibition.

3.5 DNA isolation, PCR, and agarose gel electrophoresis

Total DNA from APsulloc 331261 and APsulloc 331266 was extracted using a G-spin™ Total DNA Extraction Mini Kit (iNtRON BIOTECHNOLOGY, Gyeonggi-do, South Korea), following the manufacturer’s protocol. A set of primers (listed in Table 2[35]) used to amplify plantaricin genes was designed and PCR was performed using a 2X TOPsimple™ PreMIX-nTaq (Enzynomics, Daejeon, South Korea) and SimpliAmp Thermal Cycler (Applied Biosystems, Foster City, CA, USA), as previously described [35]. The PCR conditions were as follows: initial denaturation at 94 C for 2 min, followed by 30 cycles of denaturation at 94 C for 15 s, annealing at 60 C for 30 s, and elongation at 72 C for 1 min, and a final elongation step at 72 C for 4 min. The PCR amplicons were subjected to 3.0% (w/v) agarose gel electrophoresis at 100 V for 40 min. The gel was visualized using the ChemiDoc™ MP Imaging System Universal hood III (Bio-Rad, Hercules, CA, USA) with Image Lab™ Software Version 5.2 (Bio-Rad).

Table 2.PCR primers used in this study.
Target gene Forward primer (5′3′) Reverse primer (5′3′)
plnA GTACAGTACTAATGGGAG CTTACGCCATCTATACG
plnH TCTTACACGATCAAGGCAAC TGTGCCATTACTTACCTGTTTC
plnG TGCGGTTATCAGTATGTCAAAG CCTCGAAACAATTTCCCCC
plnEF GGCATAGTTAAAATTCCCCCC CAGGTTGCCGCAAAAAAAG
plnJ TAACGACGGATTGCTCTG AATCAAGGAATTATCACATTAGTC
plnK AATCGCAGTGACTTCCAGAAC AGAGCAATCCGTCGTTAATAAATG
plnS GCCTTACCAGCGTAATGCCC CTGGTGATGCAATCGTTAGTTT
plnW TCACACGAAATATTCCA GGCAAGCGTAAGAAATAAATGAG
plnN ATTGCCGGGTTAGGTATCG CCTAAACCATGCCATGCAC
plnNC8αβ GGTCTGCGTATAAGCATCGC AAATTGAACATATGGGTGCTTTAAATTCC
3.6 Statistical analysis

The data of this study are presented as the mean ± standard deviation (SD) from at least three independent experiments with triplicate samples. For co-cultured assay, cultivation assay, and plate agar overlay assay, multiple groups were analyzed using Bonferroni’s test for multiple comparisons of one-way analysis of variance (ANOVA) using GraphPad Prism 7.0 (GraphPad Software Inc., San Diego, CA, USA). p-values of <0.05, <0.01, and <0.001 were considered statistically significant.

4. Results
4.1 APsulloc 331261 and APsulloc 331266 inhibit the growth of S. aureus

The antibacterial activity of APsulloc 331261 and APsulloc 331266 against S. aureus was examined by a viability assay with a transwell chamber. With APsulloc 331261 or APsulloc 331266 in the apical compartment and S. aureus in the basolateral compartment, they can interact via metabolites in their shared medium while being physically separated by a membrane. S. aureus was co-cultured with APsulloc 331261 or APsulloc 331266 in S. aureus to APsulloc 331261 or APsulloc 331266 ratios of 1:0.001, 1:0.01, 1:0.1, 1:1. These experiments revealed that S. aureus growth drastically decreased even in the ratio 1:0.001 of S. aureus to APsulloc 331261or APsulloc 331266 (Fig. 1A). APsulloc 331261 or APsulloc 331266 at ratio 1:0.001, 1:0.01, 1:0.1 and 1:1 reduced the growth of S. aureus by 86.6%, 88.9%, 90.0%, and 93.2%, respectively, or 86.8%, 89.7%, 89.7%, and 93.9%, respectively. We also tested the effect of various concentrations (2.5, 5, 10, 25 and 50%) of CM-derived from APsulloc 331261 or APsulloc 331266, which is cell-free supernatant containing soluble factors,on the growth of S. aureus. We found that the growth of S. aureus was suppressed by CM-derived from APsulloc 331261 or APsulloc 331266 in a dose-dependent manner (Fig. 1B). 50% of CM-derived from APsulloc 331261 and APsulloc 331266 completely inhibited S. aureus growth by 97.7% and 98.6%, respectively, and 2.5–25% CM-derived from APsulloc 331261 and APsulloc 331266 resulted in 21–31% and 21–29% growth inhibition, respectively. Therefore, APsulloc 331261 and APsulloc 331266 exhibit anti-bacterial activity against pathogenic S. aureus, which may be mediated by APsulloc 331261 and APsulloc 331266-derived metabolites.

Fig. 1.

Antibacterial effect of APsulloc 331261 or APsulloc 331266 against S. aureus. (A) S. aureus were co-cultured in the presence or absence of APsulloc 331261 or APsulloc 331266 in the inserts of transwells at APsulloc 331261 and APsulloc 331266 to S. aureus ratios of 0.001:1, 0.01:1, 0.1:1 and 1:1. (B) S. aureus were incubated in various concentrations of CM (0, 5, 10, 25, and 50%) derived from APsulloc 331261 or APsulloc 331266. After incubation at 37 C for 48 h, the cell viabilities were determined at OD600. (C,D) Various populations (1 × 104, 2 × 104, 4 × 104 CFU) of APsulloc 331261 or APsulloc 331266 were spot inoculated on MRS agar plates and incubated for 48 h, which were overlaid with TS agar containing S. aureus for 24 h. ZDI and R value were determined by the measurement of spots around APsulloc 331261 and APsulloc 331266 strains. All data represent the mean ± standard deviation (SD) from at least three independent experiments with triple samples. Statistical analysis performed by ANOVA/Bonferroni/GraphPad Prism. Significant differences: *** p < 0.001 vs. (-), ##p < 0.01 vs. 1 × 104 CFU of initial inoculation.

Antimicrobial activity of APsulloc 331261 and APsulloc 331266 against S. aureus was further examined by agar overlay assay. Various populations (1 × 104, 2 × 104, 4 × 104 CFU) of APsulloc 331261 or APsulloc 331266 were spot inoculated on MRS agar plates, which were overlaid with TS agar containing S. aureus. We determined the growth inhibition of S. aureus by the measurement of zone of diameter inhibition (ZDI) and the wide of clear zone (R value). APsulloc 331261 or APsulloc 331266 spotted at 1 × 104, 2 × 104 and 4 × 104 CFU inhibited the growth of S. aureus with ZDI of 22.7 ± 0.6, 26.2 ± 2 and 32.3 ± 2.1 mm, respectively, in a dose dependent manner or 20.3 ± 2.1, 26.7 ± 3.1 and 28.7 ± 4.2 mm, respectively (Fig. 1C,D). Furthermore, R values for APsulloc 331261 or APsulloc 331266 against S. aureus ranged 6.8 ± 0.3–0.8 ± 1.3 mm or 5.7 ± 0.8–7.7 ± 1.4 mm, respectively, indicating the high inhibition capacity of APsulloc 331261 and APsulloc 331266 against S. aureus, but there was no dose dependent effect of APsulloc 331261 and APsulloc 331266 on R value. This might be due to dose dependent growth of APsulloc 331261 and APsulloc 331266 on the agar plate despite of its effect on dose dependent inhibition of the S. aureus growth. Collectively, agar overlay assay suggests that APsulloc 331261 and APsulloc 331266 exhibit strong inhibition (ZDI >20 mm, R value >6) against S. aureus. Taken all together, APsulloc 331261 and APsulloc 331266 have significant antibacterial effect against skin pathogenic S. aureus.

4.2 APsulloc 331261 and APsulloc 331266 suppress the growth of C. acnes

To determine antibacterial activity of APsulloc 331261 and APsulloc 331266, the viability of C. acnes co-cultured with APsulloc 331261 or APsulloc 331266 in a transwell chamber was evaluated. C. acnes located in the basolateral compartment and APsulloc 331261 or APsulloc 331266 located in the apical compartment were co-cultured in C. acnes to APsulloc 331261 or APsulloc 331266 ratios of 1:0.001, 1:0.01, 1:0.1, 1:1. These experiments showed that C. acnes growth drastically suppressed by 98.4–99.4% even in the ratio 1:0.001 of APsulloc 331261 or APsulloc 331266 to C. acnes (Fig. 2A). Next, we tested various concentrations (5, 10, 25 and 50%) of CM-derived from APsulloc 331261 or APsulloc 331266 on the growth of C. acnes. CM-derived from APsulloc 331261 and APsulloc 331266 suppressed the C. acnes growth in a dose dependent manner (Fig. 2B). 50% and 25% of APsulloc 331261 or APsulloc 331266 caused significant reduction of C. acnes growth by 96.5% and 74.4%, respectively, or, 99.9% and 98.8%, respectively. Collectively, APsulloc 331261 and APsulloc 331266-derived soluble factors effectively inhibit the C. acnes growth.

Fig. 2.

Antibacterial activity of APsulloc 331261 and APsulloc 331266 against C. acnes.(A) Using anaerobe container systems, APsulloc 331261 or APsulloc 331266 was co-cultured with C. acnes at ratios of 0.001:1, 0.01:1, 0.1:1 and 1:1. (B) C. acnes were incubated in various concentrations of CM (0, 5, 10, 25, and 50%). After anaerobic incubation at 37 C for 96 h, the cell viabilities were determined at OD600. (C,D) ZDI and R value of plate agar overlay assay with C. acnes were determined. All data represent the mean ± standard deviation (SD) from at least three independent experiments with triple samples. Significant differences: *** p < 0.001 vs. (-), #p < 0.05, ##p < 0.01 vs. 1 × 104 CFU of initial inoculation.

Antimicrobial activity of APsulloc 331261 and APsulloc 331266 against C. acnes was determined by agar overlay methods. We determined antimicrobial activity of various concentrations (1 × 104, 2 × 104 and 4 × 104 CFU of APsulloc 331261 or APsulloc 331266) by the measurement of ZDI and R value. APsulloc 331261 or APsulloc 331266 spotted at 1 × 104, 2 × 104 and 4 × 104 CFU inhibited the growth of C. acnes with ZDI of 15.0 ± 1.7, 19.0 ± 0 and 22.2 ± 1.7 mm, respectively, or, with 15.0 ± 2.6, 17.3 ± 2.1 and 20.0 ± 2.0 mm, respectively (Fig. 2C,D). R values for APsulloc 331261 and APsulloc 331266 against C. acnes ranged 3.2 ± 1.3–5.5 ± 1.3 mm and 3.7 ± 1.3–4.3 ± 1.8 mm, respectively, indicating low inhibition capacity of APsulloc 331261 and APsulloc 331266 against C. acnes. Therefore, the results of agar overlay suggest that APsulloc 331261 and APsulloc 331266 exhibit intermediate inhibition (ZDI 10–20 mm, R value 2–5) against C. acnes.

4.3 The growth of C. albicans was inhibited by APsulloc 331261 and APsulloc 331266

The viability of C. albicans co-cultured with APsulloc 331261 or APsulloc 331266 in a transwell chamber was evaluated. These experiments revealed that, C. albicans to APsulloc 331261 or APsulloc 331266 at ratio 1:0.001, 1:0.01, 1:0.1 and 1:1 decreased C. albicans growth by 0, 21.4, 44.1 and 68.2%, respectively, or by 20.6, 33.0, 44.6 and 65.1%, respectively (Fig. 3A). Next, we tested various concentrations (25, 50, 75 and 100%) of CM-derived from APsulloc 331261 or APsulloc 331266 on the vaibiity of C. albicans. The viability assays exhibited that the growth of C. albicans was suppressed by CM-derived from APsulloc 331261 or APsulloc 331266 in a dose-dependent manner. 100% and 75% of CM-derived from APsulloc 331261 or APsulloc 331266 caused significant reduction of C. albicans growth by 65.4% and 37.3%, respectively, or 75.8% and 61.9%, respectively (Fig. 3B). Collectively, APsulloc 331261 and APsulloc 331266 secreted metabolites effectively abolish the growth of pathogenic C. albicans.

Fig. 3.

Antifungal activity of APsulloc 331261 and APsulloc 331266 against C. albicans.(A) APsulloc 331261 or APsulloc 331266 was co-cultured with C. albicans at ratios of 0.001:1, 0.01:1, 0.1:1 and 1:1. (B) C. albicans were incubated in various concentrations of CM (0, 25, 50, 75, and 100%). After incubation at 37 C for 48 h, the cell viabilities were determined at OD600. (C,D) ZDI and R value of plate agar overlay assay with C. albicans were determined. All data represent the mean ± standard deviation (SD) from at least three independent experiments with triple samples. Significant differences: *p < 0.05, **p < 0.01, ***p < 0.001 vs. (-), #p < 0.05, ##p < 0.01 vs. 1 × 104 CFU of initial inoculation.

Agar overlay assay was conducted to determine the effect of APsulloc 331261 or APsulloc 331266 on C. albicans growth. APsulloc 331261 or APsulloc 331266 spotted at 1 × 104, 2 × 104 and 4 × 104 CFU inhibited the growth of C. albicans with ZDI of 13.3 ± 4.0, 19.7 ± 1.5 or 23.0 ± 2.1 mm, respectively, or 15.0 ± 1.7, 15.0 ± 1.0 and 27.0 ± 3.6 mm, respectively, in a dose dependent manner. APsulloc 331261 or APsulloc 331266 spotted at 4×104 CFU exhibited strong inhibition (ZDI >20 mm) and APsulloc 331261 or APsulloc 331266 spotted at 1 × 104 and 2 × 104 CFU showed intermediate inhibition (ZDI 10–20 mm) against C. albicans (Fig. 3C,D). R values for APsulloc 331261 or APsulloc 331266 against C. albicans ranged 2.8 ± 1.9–4.7 ± 0.3 mm or 3.2 ± 0.8–5.5 ± 1.7 mm, respectively, against C. albicans, indicating intermediate inhibition capacity inhibition (R value 2–5) of APsulloc 331261 and APsulloc 331266 against the C. albicans growth. Therefore, APsulloc 331261 and APsulloc 331266 presented intermediate to high inhibition against the growth of C. albicans.

4.4 The growth of M. globosa and M. restricta was suppressed by APsulloc 331261 and APsulloc 331266

To examine antifungal activity, the viability of M. globosa and M. restricta co-cultured with APsulloc 331261 and APsulloc 331266 was evaluated in a transwell chamber. These experiments revealed that M. globosa and M. restricta growth was significantly decreased in the presence of APsulloc 331261 or APsulloc 331266 at ratio 1:0.1 and 1:1 (Fig. 4A,C). We also tested the effect of various concentrations (25, 50, 75 and 100%) of CM-derived from APsulloc 331261 or APsulloc 331266 on the viability of M. globosa and M. restricta. These experiments demonstrated that the viability of M. globosa and M. restricta was suppressed by CM obtained from APsulloc 331261 or APsulloc 331266 in a dose-dependent manner (Fig. 4B,D). APsulloc 331261 or APsulloc 331266 derived CM was effective in inhibition of M. globosa and M. restricta growth in a dose dependent manner and 100% of CM completely abolished the growth of M. globosa and M. restricta. Collectively, APsulloc 331261 and APsulloc 331266, and their CM was effective in the inhibition of M. globosa and M. restricta growth.

Fig. 4.

Antifungal effect of APsulloc 331261 and APsulloc 331266 against M. globosa and M. restricta. (A,C) APsulloc 331261 or APsulloc 331266 was co-cultured with M. globosa or M. restricta at ratios of 0.1:1 and 1:1. (B,D) M. globosa or M. restricta were incubated in various concentrations of CM (0, 25, 50, 75, and 100%) After incubation at 30 C for 72 h, cell viabilities were determined at OD600. All data represent the mean ± standard deviation (SD) from at least three independent experiments with triple samples. Significant differences:*p < 0.05 vs. (-). Gel electrophoresis of PCR amplicons of pln genes in APsulloc 331261 (E) and APsulloc 331266 (F). Lane1, ladder; Lane2, Control; Lane3-12, pln gene; Lanes 13, ladder.

Plantaricin, a bacteroicin produced in L. plantarum, is known to have an antimicrobial effect [36]. To determine whether APsulloc 331261 and APsulloc 331266 express plantaricin genes, we evaluated ten genes, which are present in the pln locus and are responsible for the synthesis of plantaricins. PCR analysis showed that plnA,plnH,plnG,plnEF, plnJ,plnK, and plnN genes exist in APsulloc 331261 and APsulloc 331266, and that plnS,plnW, and plnNC8αβ genes do not exist (Fig. 4E,F). The plantaricin genes such as plantaricin S and plantaricin W are rarely presented in the L. plantarum strains [36]. Taken together, Genes plnA, plnH,plnG,plnEF,plnJ,plnK, and plnN were found in APsulloc 331261 and APsulloc 331266, which may render its antimicrobial activity against pathogenic skin microbes.

5. Discussion

The usage of probiotics to promote gut and immune health has recently grown, and researchers are interested in the discovery of a variety of probiotic strains and mechanisms how probiotic microorganisms interact with the body [37]. Probiotics play an potential alternative to antibiotics in the treatment of inflammatory bowel disease (IBD) [38] as well as lower the incidence of several atopic conditions [39,40]. Among the commercially available probiotic strains, LAB from various natural sources are being isolated and identified to explore new alternative probiotic strains [41]. Probiotic Lactoplantibacillus species can be considered to be candidates for alternatives to antibiotics since their various mechanisms of growth inhibition against pathogenic bacteria have been extensively documented [42-44]. Lactiplantibacillus species isolated from various sources have an excellent antibacterial spectrum against pathogenic bacteria [5,45,46]. The antagonistic activity of Lactiplantibacillus species has mostly been attributed to the production of lactic acid. The acidification of cytoplasm of cell by the undissociated lactic acid that passes through the bacterial membrane and dissociates inside the cell results in failure of proton motive forces [47]. Besides organic acids, hydrogen peroxides, bacteriocins, and short-chain fatty acids (such as acetic, propionic, and butyric acids) are antimicrobial compounds produced by Lactiplantibacillus species, and the compounds lead to the change of the gut redox potential and the restriction of the nutrient supply to the pathogens [48]. In particular, L. plantarum synthesize a variety of antimicrobial plantaricins to inhibit the growth of competing bacteria. Plantaricin A, which plnA is encoded, acts as an extracellular signal that induces transcription of pln genes as well as an antimicrobial peptides [49]. Even though plantaricin E, F, J and K, encoded by plnE, plnF,plnJ and plnK, respectively, have an anti-microbial effect individually, two peptides are at least 1000 times more effective when cognate peptides such as PlnE and PlnF, or, PlnJ and PlnK, are combined [50]. Moreover, antifungal activity of plantaricin peptides PlnE, -F, -J, and -K is presented against pathogenic yeast, Candida albicans [51]. Plantaricin EF and JK form holes in the membrane of the target cell and cause the death by electronical potential and pH gradient to collapse [52,53]. However, plantaricin EF and JK have different receptor [54]. plnH and plnG is related to ABC transport, which secrete and process pre-plantaricin E, F, J, and K to reveal the antimicrobial activity [52]. Yolanda et al. [55] classified the L. plantarum strains into seven plantaritypes, depending on the presence of the bacteriocin gene and the type of regulatory system. Both APsulloc 331261 and APsulloc 331266 do not have plnNC8, but plnA does exist, suggesting that they belong to group 1 and 2 of plantaritypes and have common characteristics of plnABCD regulation systems. Thus, the presence of plantaricin genes plnA,plnH,plnG,plnEF,plnJ, plnK, and plnN in APsulloc 331261 and APsulloc 331266 might contribute to the antimicrobial activity of APsulloc 331261 and APsulloc 331266 against skin pathogens. However, we only identified plantaricin genes, not their expression or activity. For better understanding of the mechanism of antimicrobial activity of APsulloc 331261 and APsulloc 331266, further studies are needed to confirm the plantaricin expression/activity and their antimicrobial activity against skin pathogenic microbiota.

Probiotics and prebiotics have been widely considered for the treatment and prevention of infectious diseases because of the various mechanisms by sharing genes and metabolites, helping other microbiota, and directly interacting epithelial and immune cells [56]. In this regard, several studies have investigated the effects of probiotic and prebiotics use on microbiota of other parts of human body. Therefore, probiotics and prebiotics are promising in improving skin health by modulating the cutaneous microbiota [57]. The gastrointestinal microbiota can communicate with the skin through modulation of systemic immune responses and maintain skin homeostasis [58]. In fact, beneficial effects of probiotics following topical or oral administration have been reported in skin diseases, such as acne vulgaris [27,59,60], atopic dermatitis [61], candida vaginitis [62], and dandruff [63]. The use of probiotics in cosmetics or nutraceuticals have been recently expanded to rebalance the microbiome for skin by inhibiting the growth of harmful pathogens while promoting the colonization of beneficial bacteria among the resident microorganisms. Thus, topical application or ingestion of APsulloc 331261 and APsulloc 331266 could improve skin health by inhibiting skin pathogens, ameliorating intestinal beneficial bacteria [30] and inducing macrophage polarisation [31]. Although we should carefully draw conclusion obtained from in vitro studies, our results support the hypothesis that probiotic APsulloc 331261 and APsulloc 331266 may ameliorate microbial profile and homoeostasis in the skin. Further studies are guaranteed to investigate the effectiveness of APsulloc 331261 and APsulloc 331266 as novel antibiotics or alternative therapeutics for treating skin infection.

6. Conclusions

In summary, the present study demonstrated that APsulloc 331261 and APsulloc 331266 isolated from green tea (Camellia sinensis) exhibited the inhibitory activity against five skin pathogenic strains (S. aureus, C. acnes, C. albicans, M. globosa and M. restricta) related to skin diseases. Antimicrobial effect of APsulloc 331261 and APsulloc 331266 was validated by indirect co-culture assay, CM culture assay and agar overlay assay with five pathogenic strains. These results indicate that novel APsulloc 331261 and APsulloc 331266 could serve as a potential alternative to antibiotics against infectious diseases. Further studies are guaranteed to explore the effectiveness of APsulloc 331261 and APsulloc 331266 administrated by topically or orally as alternative therapeutics in combating skin infection.

7. Author contributions

MC, BJK and JN designed the research and wrote the paper. JN, JOL and SYK performed the experiments and statistical analyses. YK, EL, DC, JR and WK prepared figures. All authors analysed and interpreted the data, revised the manuscript, and approved the final draft.

8. Ethics approval and consent to participate

Not applicable.

9. Acknowledgment

Thanks to all the peer reviewers for their opinions and suggestions.

10. Funding

This research was funded by the AMOREPACIFIC R&D center (R21S200001).

11. Conflict of interest

The authors declare no conflict of interest.

Abbreviations

LAB, Lactic acid bacteria; L. plantarum, Lactiplantibacillus plantarum; APsulloc 331261, Lactiplantibacillus plantarum APsulloc 331261; APsulloc 331266, Lactiplantibacillus plantarum APsulloc 331266; S. aureus,Staphylococcus aureus; C. acnes, Cutibacterium acnes; C. albicans,Candida albicans; M. globosa,Malassezia globosa; M. restricta, Malassezia restricta; ATCC, American Type Culture Collection; CM, Cell-free conditioned media; TS, Tryptic soy; MRC, Modified reinforced Clostridium; YM, Yeast malt; MLNA, Modified Leeming & Notman agar; SD, Standard deviation; ZDI, Zone diameter of inhibition.

References
[1]
Hill C, Guarner F, Reid G, Gibson GR, Merenstein DJ, Pot B, et al. The international scientific association for probiotics and prebiotics consensus statement on the scope and appropriate use of the term probiotic. Nature Reviews Gastroenterology & Hepatology. 2014; 11: 506–514.
[2]
Wang L, Zhang H, Rehman MU, Mehmood K, Jiang X, Iqbal M, et al. Antibacterial activity of Lactobacillus plantarum isolated from Tibetan yaks. Microbial Pathogenesis. 2018; 115: 293–298.
[3]
Amara AA, Shibl A. Role of Probiotics in health improvement, infection control and disease treatment and management. Saudi Pharmaceutical Journal. 2015; 23: 107–114.
[4]
Zheng J, Wittouck S, Salvetti E, Franz CMAP, Harris HMB, Mattarelli P, et al. A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. International Journal of Systematic and Evolutionary Microbiology. 2020; 70: 2782–2858.
[5]
Halder D, Mandal M, Chatterjee SS, Pal NK, Mandal S. Indigenous probiotic Lactobacillus isolates presenting antibiotic like activity against human pathogenic bacteria. Biomedicines. 2017; 5: 31.
[6]
Cebeci A, Gürakan C. Properties of potential probiotic Lactobacillus plantarum strains. Food Microbiology. 2003; 20: 511–518.
[7]
Fijan S. Microorganisms with claimed probiotic properties: an overview of recent literature. International Journal of Environmental Research and Public Health. 2014; 11: 4745–4767.
[8]
Siamansouri M, Mozaffari S, Alikhani FE. Bacteriocins and lactic acid bacteria. Journal of Biology. 2013; 2: 227–234.
[9]
Yang S-C, Lin C-H, Sung CT, Fang J-Y. Antibacterial activities of bacteriocins: application in foods and pharmaceuticals. Frontiers in Microbiology. 2014; 5: 241.
[10]
Vogel RF, Pohle BS, Tichaczek PS, Hammes WP. The competitive advantage of Lactobacillus curvatus LTH 1174 in sausage fermentations is caused by formation of curvacin A. Systematic and Applied Microbiology. 1993; 16: 457–462.
[11]
Roth RR, James WD. Microbiology of the skin: resident flora, ecology, infection. Journal of the American Academy of Dermatology. 1989; 20: 367–390.
[12]
Grice EA, Segre JA. The skin microbiome. Nature Reviews. Microbiology. 2011; 9: 244–253.
[13]
Missiakas DM, Schneewind O. Growth and laboratory maintenance of Staphylococcus aureus. Current Protocols in Microbiology. 2013; Chapter 9: Unit–9C.1.
[14]
Dainichi T, Kitoh A, Otsuka A, Nakajima S, Nomura T, Kaplan DH, et al. The epithelial immune microenvironment (EIME) in atopic dermatitis and psoriasis. Nature Immunology. 2019; 19: 1286–1298.
[15]
Blaskovich MAT, Elliott AG, Kavanagh AM, Ramu S, Cooper MA. In vitro antimicrobial activity of acne drugs against skin-associated bacteria. Scientific Reports. 2019; 9: 14658.
[16]
Jung W-B, Kim J-H. A literature study on acne in traditional Chinese medical journals. The Journal of Pediatrics of Korean Medicine. 2007; 21: 27–40.
[17]
Son B-K, Choi I-H. Correlation between prognosis and factors on acne patients. The Journal of Korean Medicine Ophthalmology and Otolaryngology and Dermatology. 2008; 21: 113–120.
[18]
Kühbacher A, Burger-Kentischer A, Rupp S. Interaction of Candida Species with the Skin. Microorganisms. 2019; 5: 32.
[19]
Davis JD. Superficial fungal infections of the skin: Tinea corporis, tinea pedis, and Candida intertrigo. Primary Care Update for OB/GYNS. 1995; 2: 157–161.
[20]
Manolakaki D, Velmahos G, Kourkoumpetis T, Chang Y, Alam HB, De Moya MM, et al. Candida infection and colonization among trauma patients. Virulence. 2011; 1: 367–375.
[21]
Rubenstein RM, Malerich SA. Malassezia (pityrosporum) folliculitis. The Journal of Clinical and Aesthetic Dermatology. 2014; 7: 37.
[22]
Dawson TL. Malassezia globosa and restricta: Breakthrough Understanding of the Etiology and Treatment of Dandruff and Seborrheic Dermatitis through whole-Genome Analysis. Journal of Investigative Dermatology Symposium Proceedings. 2007; 12: 15–19.
[23]
Eady EA, Cove JH, Holland KT, Cunliffe WJ. Erythromycin resistant propionibacteria in antibiotic treated acne patients: association with therapeutic failure. The British Journal of Dermatology. 1989; 121: 51–57.
[24]
El-Gohary M, van Zuuren EJ, Fedorowicz Z, Burgess H, Doney L, Stuart B, et al. Topical antifungal treatments for tinea cruris and tinea corporis. The Cochrane Database of Systematic Reviews. 2014; 8: CD009992.
[25]
Kaushik M, Kumar S, Kapoor RK, Gulati P. Integrons and antibiotic resistance genes in water-borne pathogens: threat detection and risk assessment. Journal of Medical Microbiology. 2019; 68: 679–692.
[26]
Bowe WP, Logan AC. Acne vulgaris, probiotics and the gut-brain-skin axis - back to the future? Gut Pathogens. 2011; 3: 1.
[27]
Muizzuddin N, Maher W, Sullivan M, Schnittger S, Mammone T. Physiological effect of a probiotic on skin. Journal of Cosmetic Science. 2013; 63: 385–395.
[28]
Ghosh C, Sarkar P, Issa R, Haldar J. Alternatives to Conventional Antibiotics in the Era of Antimicrobial Resistance. Trends in Microbiology. 2019; 27: 323–338.
[29]
Arellano K, Vazquez J, Park H, Lim J, Ji Y, Kang H, et al. Safety Evaluation and whole-Genome Annotation of Lactobacillus plantarum Strains from Different Sources with Special Focus on Isolates from Green Tea. Probiotics and Antimicrobial Proteins. 2020; 12: 1057–1070.
[30]
Park H, Cho D, Huang E, Seo JY, Kim WG, Todorov SD, et al. Amelioration of alcohol induced gastric ulcers through the administration of lactobacillus Plantarum apsulloc 331261 isolated from green tea. Frontiers in Microbiology. 2020; 11: 420.
[31]
Kim W, Lee EJ, Bae I-H, Myoung K, Kim ST, Park PJ, et al. Lactobacillus plantarum-derived extracellular vesicles induce anti-inflammatory M2 macrophage polarization in vitro. Journal of Extracellular Vesicles. 2020; 9: 1793514.
[32]
Köhler GA, Assefa S, Reid G. Probiotic interference of Lactobacillus rhamnosus GR-1 and Lactobacillus reuteri RC-14 with the opportunistic fungal pathogen Candida albicans. Infectious Diseases in Obstetrics and Gynecology. 2012; 2012: 636474.
[33]
Mizuno K, Mizuno M, Yamauchi M, Takemura AJ, Medrano Romero V, Morikawa K. Adjacent-possible ecological niche: growth of Lactobacillus species co-cultured with Escherichia coli in a synthetic minimal medium. Scientific Reports. 2019; 7: 12880.
[34]
Shokryazdan P, Sieo CC, Kalavathy R, Liang JB, Alitheen NB, Faseleh Jahromi M, et al. Probiotic potential of Lactobacillus strains with antimicrobial activity against some human pathogenic strains. BioMed Research International. 2015; 2014: 927268.
[35]
Rizzello CG, Filannino P, Di Cagno R, Calasso M, Gobbetti M. Quorum-sensing regulation of constitutive plantaricin by Lactobacillus plantarum strains under a model system for vegetables and fruits. Applied and Environmental Microbiology. 2014; 80: 777–787.
[36]
Pal G, Srivastava S. Inhibitory effect of plantaricin peptides (Pln E/F and J/K) against Escherichia coli. World Journal of Microbiology & Biotechnology. 2015; 30: 2829–2837.
[37]
Reardon S. Microbiome therapy gains market traction. Nature. 2014; 509: 269–270.
[38]
Gionchetti P, Rizzello F, Lammers K, Morselli C, Sollazzi L, Davies S, et al. Antibiotics and probiotics in treatment of inflammatory bowel disease. World Journal of Gastroenterology. 2006; 12: 3306–3313.
[39]
Gill HS. Probiotics and human health: a clinical perspective. Postgraduate Medical Journal. 2004; 80: 516–526.
[40]
Kalliomäki M, Salminen S, Arvilommi H, Kero P, Koskinen P, Isolauri E. Probiotics in primary prevention of atopic disease: a randomised placebo-controlled trial. Lancet. 2001; 357: 1076–1079.
[41]
Samuel SS, Shukla S, Ramteke P. Isolation and identification of antagonistic Lactobacillus spp. isolated from dairy products against selected pathogens. The Pharma Innovation. 2016; 5: 8.
[42]
Bermudez-Brito M, Plaza-Díaz J, Muñoz-Quezada S, Gómez-Llorente C, Gil A. Probiotic mechanisms of action. Annals of Nutrition & Metabolism. 2013; 61: 160–174.
[43]
Roudsari MR, Karimi R, Sohrabvandi S, Mortazavian AM. Health effects of probiotics on the skin. Critical Reviews in Food Science and Nutrition. 2016; 55: 1219–1240.
[44]
Gogineni VK, Morrow LE, Malesker M. Probiotics: mechanisms of action and clinical applications. Journal of Probiotics & Health. 2013; 1: 1–11.
[45]
Manzoor A, Ul-Haq I, Baig S, Qazi JI, Seratlic S. Efficacy of Locally Isolated Lactic Acid Bacteria against Antibiotic-Resistant Uropathogens. Jundishapur Journal of Microbiology. 2016; 9: e18952.
[46]
Mashak Z. Antimicrobial activity of lactobacillus isolated from kashk-e zard and tarkhineh, two Iranian traditional fermented foods. International Journal of Enteric Pathogens. 2016; 4: 1–5.
[47]
Lund P, Tramonti A, De Biase D. Coping with low pH: molecular strategies in neutralophilic bacteria. FEMS Microbiology Reviews. 2015; 38: 1091–1125.
[48]
Suskovic J, Kos B, Beganovic J, Pavunc AL, Habjanic K, Matosic S. Antimicrobial activity - the most important property of probiotic and starter lactic acid bacteria. Food Technol Biotechnol. 2010; 48: 296–307.
[49]
Chanos P, Mygind T. Co-culture-inducible bacteriocin production in lactic acid bacteria. Applied Microbiology and Biotechnology. 2016; 100: 4297–4308.
[50]
Anderssen EL, Diep DB, Nes IF, Eijsink VG, Nissen-Meyer J. Antagonistic activity of Lactobacillus plantarum C11: two new two-peptide bacteriocins, plantaricins EF and JK, and the induction factor plantaricin a. Applied and Environmental Microbiology. 1998; 64: 2269–2272.
[51]
Sharma A, Srivastava S. Anti-Candida activity of two-peptide bacteriocins, plantaricins (Pln E/F and J/K) and their mode of action. Fungal Biology. 2014; 118: 264–275.
[52]
Diep DB, Straume D, Kjos M, Torres C, Nes IF. An overview of the mosaic bacteriocin pln loci from Lactobacillus plantarum. Peptides. 2009; 30: 1562–1574.
[53]
Moll GN, van den Akker E, Hauge HH, Nissen-Meyer J, Nes IF, Konings WN, et al. Complementary and overlapping selectivity of the two-peptide bacteriocins plantaricin EF and JK. Journal of Bacteriology. 1999; 181: 4848–4852.
[54]
Oppegård C, Kjos M, Veening J, Nissen-Meyer J, Kristensen T. A putative amino acid transporter determines sensitivity to the two-peptide bacteriocin plantaricin JK. MicrobiologyOpen. 2017; 5: 700–708.
[55]
Sáenz Y, Rojo-Bezares B, Navarro L, Díez L, Somalo S, Zarazaga M, et al. Genetic diversity of the pln locus among oenological Lactobacillus plantarum strains. International Journal of Food Microbiology. 2009; 134: 176–183.
[56]
Wieers G, Belkhir L, Enaud R, Leclercq S, Philippart de Foy JM, Dequenne I, et al. How probiotics affect the microbiota. Frontiers in Cellular and Infection Microbiology. 2019; 9: 454.
[57]
Al-Ghazzewi FH, Tester RF. Impact of prebiotics and probiotics on skin health. Beneficial Microbes. 2014; 5: 99–107.
[58]
O’Neill CA, Monteleone G, McLaughlin JT, Paus R. The gut-skin axis in health and disease: a paradigm with therapeutic implications. BioEssays. 2017; 38: 1167–1176.
[59]
Jung GW, Tse JE, Guiha I, Rao J. Prospective, randomized, open-label trial comparing the safety, efficacy, and tolerability of an acne treatment regimen with and without a probiotic supplement and minocycline in subjects with mild to moderate acne. Journal of Cutaneous Medicine and Surgery. 2013; 17: 114–122.
[60]
Kang BS, Seo J, Lee G, Kim J, Kim SY, Han YW, et al. Antimicrobial activity of enterocins from Enterococcus faecalis SL-5 against Propionibacterium acnes, the causative agent in acne vulgaris, and its therapeutic effect. The Journal of Microbiology. 2009; 47: 101–109.
[61]
Prakoeswa CRS, Herwanto N, Prameswari R, Astari L, Sawitri S, Hidayati AN, et al. Lactobacillus plantarum is-10506 supplementation reduced SCORAD in children with atopic dermatitis. Beneficial Microbes. 2017; 8: 833–840.
[62]
De Seta F, Parazzini F, De Leo R, Banco R, Maso GP, De Santo D, et al. Lactobacillus plantarum P17630 for preventing Candida vaginitis recurrence: a retrospective comparative study. European Journal of Obstetrics & Gynecology and Reproductive Biology. 2015; 182: 136–139.
[63]
Reygagne P, Bastien P, Couavoux MP, Philippe D, Renouf M, Castiel-Higounenc I, et al. The positive benefit of Lactobacillus paracasei NCC2461 ST11 in healthy volunteers with moderate to severe dandruff. Beneficial Microbes. 2017; 8: 671–680.
Publisher’s Note: IMR Press stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Share
Back to top