Decreased Expression of Cav-1 Is Associated with Compromised Endometrial Angiogenesis during the Implantation Window in PCOS Rats: A Prospective Randomized Laboratory-Based Study

Huayun Xu¹, Guozeng Wang^2,*

Show Less

¹ Department of Traditional Chinese Medicine, Shanghai General Hospital, School of Medicine, Shanghai Jiao Tong University, 200080 Shanghai, China

² Department of Obstetrics and Gynecology, Shanghai East Hospital, School of Medicine, Tongji University, 200120 Shanghai, China

^*Correspondence: zengerwong@126.com (Guozeng Wang)

Clin. Exp. Obstet. Gynecol. 2024, 51(1), 4; https://doi.org/10.31083/j.ceog5101004

Submitted: 25 May 2023 | Revised: 15 August 2023 | Accepted: 22 August 2023 | Published: 8 January 2024

This is an open access article under the CC BY 4.0 license.

Download PDF

Brower Figures

Cite

Abstract

Background: Caveolin-1 (Cav-1) is known to regulate angiogenesis. However, little is known about Cav-1’s role in polycystic ovary syndrome (PCOS). This study aims to investigate Cav-1’s expression in the endometrium of PCOS rats during the implantation window and its association with endometrial angiogenesis. Methods: Female Sprague Dawley (SD) rats were randomly divided into the control and PCOS groups. The rats in the PCOS group mated after ovulation induction, while the rats in the control group mated during the estrus period. On the 2nd and 5th days of pregnancy, the rats were sacrificed, and the endometrium was isolated from their uteruses. Immunohistochemistry (IHC) staining of CD34 was used to evaluate the endometrial micro-vessel density (MVD). The expression of Cav-1 and vascular endothelial growth factor (VEGF) in the endometrium of both groups was assessed through IHC staining and real-time reverse transcription polymerase chain reaction (RT-PCR) analysis. Results: IHC analysis of endometrium tissue sections showed reduced MVD in PCOS rats on both the 2nd and 5th days of pregnancy. The endometrial expression of Cav-1 and VEGF were also significantly downregulated in the PCOS group compared to the control group during the implantation window. Interestingly, the endometrial expression of Cav-1 was positively correlated with MVD and VEGF. Conclusions: Our study demonstrated the decreased endometrial angiogenesis in PCOS rats during implantation window. This decrease was linked to decreased Cav-1 expression, suggesting Cav-1 is a potential therapeutic target for PCOS patients.

Keywords

Cav-1

endometrial angiogenesis

endometrial receptivity

polycystic ovarian syndrome

1. Introduction

Polycystic ovary syndrome (PCOS) is a dysovulation disorder that affects female reproductive endocrine and metabolic dysfunction, leading to infertility in women [1]. While methods to promote follicle maturation and induce ovulation can improve ovulation rates, PCOS patients still face challenges with low pregnancy and high abortion rates [2, 3]. Previous research has identified that PCOS patients experience issues with endometrial development and embryo receptivity, which contributes to infertility following ovulation promotion [4]. Good endometrial blood perfusion is an important condition for the establishment of endometrial receptivity. Insulin resistance [5, 6], high luteinizing hormone, and high androgen [7, 8] can lead to insufficient uterine blood perfusion in PCOS patients, which negatively impacts endometrial receptivity [9].

Caveolin-1 (Cav-1) is a surface marker protein of plasma membrane vesicles. It is abundantly expressed in endothelial cells, participates in cell proliferation and differentiation, tissue angiogenesis, and signal transduction, and is closely related to angiogenesis [10]. At present, it has been widely reported that Cav-1 regulated tumor growth and angiogenesis following cerebral ischemia, however, its role in endometrial receptivity remains unstudied. This study aims to investigate the Cav-1 expression in the endometrium of PCOS rats during the implantation window period and examine its correlation relationship with endometrial angiogenesis, to discover potential therapeutic targets for improving the endometrial receptivity of PCOS patients.

2. Materials and Methods

2.1 Experimental Animals

Twelve virgin female Sprague Dawley (SD) rats weighing about 50 $\pm{}$ 10 g were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., at the age of three weeks. Animals were housed in standard animal houses, and all animal experiments complied with Animal Research: Reporting of in vivoExperiments (ARRIVE) guidelines and were carried out following the Ethical Committee guidelines on the use of experimental animals at Shanghai Jiao Tong University, School of Medicine.

2.2 Construction of PCOS Model and Rat Mating

Rats were fed adaptively for three days and randomly divided into the PCOS group (n = 6) and the control group (n = 6). The PCOS group was fed a high-fat pellet feed (Wuxi Fan Bo Biotechnology Co., Ltd, Wuxi, Jinagsu, China). According to Lee MT et al. [11], dehydroepiandrosterone (DHEA, 60 mg/kg) (Sigma-Aldrich, St. Louis, MO, USA) was dissolved in 0.2 mL oil injection (Sigma-Aldrich, St. Louis, MO, USA). The rats in the control group were subcutaneously injected with 0.2 mL oil injection on the back of the neck every day, and those in the PCOS group were subcutaneously injected with 0.2 mL DHEA + oil injection on the back of the neck every day for 20 days. Vaginal smears were taken from the 10th day of injection to observe the two estrous cycles. The continuous appearance of keratinocytes indicated the successful establishment of the PCOS model. Afterward, the PCOS group received 0.52 mg/kg letrozole (Jiangsu Hengrui Pharmaceutical Co., LTD, Lianyungang, Jiangsu, China) by gavage, while the control group received 2.1 mL/kg normal saline by gavage. At 04:00 PM on the 2nd day after gavage, female and male SD rats in both groups mated during estrus in a ratio of 1:1. The presence of a vaginal plug the next morning indicated pregnancy.

2.3 Tissue Processing

The rats in both groups were sacrificed on the 2nd and 5th days of pregnancy. Under the aseptic condition, the bilateral uteruses were removed and the endometrium was separated by cutting the uterine horn.

2.4 Observation Parameters

2.4.1 Estrous Cycle and Weight Change

Vaginal smears of rats were obtained and fixed every morning beginning on the 10th day of oil injection, and the changes in the estrous cycle were then analyzed under a microscope (Olympus Corporation, Tokyo, Japan). Furthermore, the rats’ bodyweight was assessed once a week.

2.4.2 Immunohistochemistry for Micro-Vessel Density (MVD), Cav-1, and Vascular Endothelial Growth Factor (VEGF)

Endometrial tissue from rats was extracted and fixed in paraffin on the 2nd and 5th day of pregnancy, as described aboved. The following procedures were used for immunohistochemistry (IHC) staining: deparaffinization of tissue slides was followed by antigen retrieval. The slides were incubated with primary antibodies (as mentioned below), followed by horseradish peroxidase (HRP)-conjugated secondary antibodies (as mentioned below), and diaminobenzidine (DAB, Abcam, Fremont, CA, USA) after endogenous peroxidase was blocked with 3% H ${}_{2}$ O ${}_{2}$ solution. The slides were then counterstained with hematoxylin (Abcam, Cambridge, CA, USA). The following primary antibodies were used: CD34 (ab198823, Abcam, Cambridge, CA, USA) 1:2500 dilution; vascular endothelial growth factor A (VEGFA) (ab1316, Abcam, Cambridge, CA, USA) 1:250 dilution; Caveolin-1 (ab32577, Abcam, Cambridge, CA, USA) 1:2000 dilution. The secondary antibodies were: Biotinylated goat-anti-rabbit IgG (Beyotime, A0208, Shanghai, China) 1:50 dilution; Biotinylated goat-anti-mouse IgG (Beyotime, A0216) 1:50 dilution. The micro-vessel density (MVD) of immunohistochemical endometrial sections was determined using the standard of Weidner et al. [12].

2.4.3 Real-Time RT-PCR Analysis of Cav-1 and VEGF Expression

The endometrium of the 5th day of pregnancy was harvested and homogenized, and total RNA was extracted suing Trizol (Invitrogen, Carlsbad, CA, USA). Then, 1 µg of extracted total RNA was reverse transcribed using the Reverse transcription kit following the manufacturer’s instructions (Ambion Company, Austin, TX, USA), and 10 ng cDNA was used for PCR amplification (PrimeScript™ RT reagent Kit, TAKARA, Kusatsu, Shiga, Japan), and mRNA expression was quantified using the 2 ${}^{-\Delta{}\Delta{}\text{ct}}$ method. The primer sequences are listed in Table 1.

Table 1.The oligonucleotide sequences of primers used for RT-PCR.

Primer name	Sequence (5′→3′)
$\beta$ -actin-F	TCGTACCACTGGCATTGTGAT
$\beta$ -actin-R	AGGGAGCGCGTAACCC
Cav-1-F	CAACGACGACGTGGTCAAGA
Cav-1-R	CATAGGGATGCCGAAGATGGT
VEGF-F	CGACAGAAGGGGAGCAGAAAG
VEGF-R	AATTGGACGGCAATAGCTGC

Cav-1, Caveolin-1; VEGF, vascular endothelial growth factor; F, Forward; R, Reverse; RT-PCR, real-time reverse transcription polymerase chain reaction.

2.5 Statistical Analysis

Statistical analysis was performed with SPSS (version 20.0; IBM, Armonk, NY, USA). All data followed normal distributions and were presented as mean $\pm{}$ standard deviation. The independent t-test was used to examine the differences between the two groups. Pearson correlation analysis was used to investigate relationships between Cav-1 and MVD/vascular endothelial growth factor (VEGF). A probability value of less than 0.05 was deemed statistically significant.

3. Results

3.1 Increased Bodyweight and Arrested Estrous Cycle in PCOS Group Rats

Starting in the fourth week, high-fat feeding induced significant weight gain in the PCOS group rats (Fig. 1). We also observed that rats in the PCOS group exhibited irregular estrous cycles during the estrus period, whereas rats in the control group had regular cycles, indicating the successful establishment of PCOS model (Fig. 2).

Fig. 1.

Bodyweight growth trend of the two groups of rats. In the PCOS group, the bodyweight increased significantly from the 4th week of high-fat feeding, and it was more evident than that in the control group at the 6th week. PCOS, polycystic ovary syndrome.

Fig. 2.

Vaginal smears. (A–D) A normal estrous cycle exists in the control group. (A) Proestrus. (B) Estrous period. (C) Metaestrus. (D) Estrus interval. (E–H) When compared with the control group, the rats in the PCOS group were always in the estrus interval and lost the regular estrous cycle after building.

3.2 Decreased MVD in PCOS Rats during Implantation Window

To evaluate the endometrial blood perfusion during pregnancy, we immunoassayed the endometrium slices with CD34, a microvessel-specific marker. As shown in the figure, on the 2nd and 5th days of pregnancy, the MVD in the PCOS group’s endometrium was significantly lower than in the control group. Furthermore, MVD increased with gestation in both control and PCOS groups, although there was no statistical significance (Fig. 3A–D).

Fig. 3.

Tissues CD34, Cav-1, and VEGF expression by IHC. (A,B) On the 2nd day of pregnancy, IHC staining for the expression of CD34. (C,D) On the 5th day of pregnancy, IHC staining for the expression of CD34. (E,F) On the 2nd day of pregnancy, IHC staining for the expression of Cav-1. (G,H) On the 5th day of pregnancy, IHC staining for the expression of Cav-1. (I,J) On the 2nd day of pregnancy, IHC staining for the expression of VEGF. (K,L) On the 5th day of pregnancy, IHC staining for the expression of VEGF. Original magnification: 200 $\times{}$ . IHC, Immunohistochemistry. MVD, micro-vessel density.

3.3 Downregulated Expression of Endometrial Cav-1 and VEGF in PCOS Rats during Implantation Window

Cav-1 and VEGF protein were mainly expressed in endometrial stromal and glandular epithelial cells [13, 14]. We utilized immunohistochemical labeling on endometrial slices to investigate the alterations in Cav-1 and VEGF expression in PCOS rat models. Our data revealed that the expression of Cav-1 and VEGF protein in the endometrium of the PCOS group was significantly lower than that of the control group during the implantation window stage. In addition, we observed slightly upregulated expression of VEGF in the PCOS group on the 5th day compared to the 2nd day. In both the control and PCOS groups, the expression of Cav-1 increased over time. However, no statistical significance was seen (Fig. 3E–L). On the 5th day of pregnancy, real-time reverse transcription polymerase chain reaction (RT-PCR) analysis revealed that the expression of Cav-1 and VEGF mRNA in the endometrium of the PCOS group was significantly lower than that of the control group (Fig. 4).

Fig. 4.

Tissues Cav-1 and VEGF mRNA expression by real-time reverse transcription polymerase chain reaction (RT-PCR). (A,B) On the 5th day of pregnancy, the expression of Cav-1 and VEGF mRNA in the endometrium of the PCOS group was significantly lower than that in the control group. A significant difference was noted between the PCOS and control groups.

3.4 Endometrial Cav-1 Expression is Associated with MVD and VEGF Expression

We further explored the association between Cav-1 and endometrial angiogenesis. Interestingly, correlation analysis showed that Cav-1 expression was positively correlated with MVD (r = 0.818, p = 0.047) and VEGF (r= 0.835, p = 0.039) in the endometrium of the PCOS group at the implantation window stage (Fig. 5), suggesting that Cav-1 regulates endometrial angiogenesis.

Fig. 5.

Association between Cav-1 and endometrial angiogenesis. (A,B) According to the correlational analysis, in the PCOS group, Cav-1 was positively correlated with MVD and the VEGF expression. The coefficient of determination of Cav-1 and VEGF was r = 0.835, p = 0.039. The coefficient of determination of Cav-1 and MVD was r = 0.818, p = 0.047.

4. Discussion

PCOS is a prevalent metabolic and ovulatory disorder in women of childbearing age, with a prevalence rate as high as 4–15% [15]. According to research, in addition to ovulation abnormalities, poor endometrial receptivity is an important cause of PCOS infertility [16, 17]. Endometrial receptivity is the ability of the endometrium to facilitate embryo implantation during a specified period [18], which necessitates appropriate endometrial blood vessel development. It is also a prerequisite for embryo implantation and pregnancy to proceed successfully [19, 20].

MVD is a crucial parameter for assessing angiogenesis. A greater extent of neovascularization is indicated by a higher MVD in tissues. Endometrial blood flow may therefore be well determined by assessing endometrial MVD by immunostaining endometrial microvascular endothelial cells with CD34 antibody [21]. Our findings revealed an increase in MVD as gestational days progressed (Fig. 3A–D). During the implantation window time, however, the MVD of the endometrium in the PCOS group was significantly lower than in the control group (Fig. 3A–D). This suggests that endometrial angiogenesis was decreased, resulting in insufficient blood flow during the implantation window in PCOS individuals.

VEGF is an important angiogenesis-promoting cytokine. According to research, VEGF primarily affects endothelial cells in endometrial vessels, stimulating their proliferation and migration [22, 23]. Because VEGF expression closely correlates with uterine blood flow, it is a significant marker of endometrial receptivity [24, 25]. Inadequate VEGF levels have been linked to decreased endometrial receptivity, which may potentially impact the development of early villi [26]. Consequently, VEGF plays an important role in endometrial neovascularization [27]. Our findings show that VEGF expression is lower in the endometrium of PCOS rats during the implantation window period (Fig. 3I–L), aligning with the lower levels of endometrial MVD in those rats. These results reinforce the notion that endometrium angiogenesis is impaired during the PCOS implantation window, potentially affecting endometrial receptivity, development, and embryo implantation. However, our data also reveal that VEGF expression is downregulated in the conrol group during gestation, which contradicts the MVD results. Given the small sample size of rats in this experiment, this discrepancy may be due to experimental errors.

Caveolae are vesicle-like structures formed by the invagination of the cytoplasmic membrane [28]. Among these structures, Cav-1 is a crucial structural protein [28] that is highly expressed in vascular endothelial cells [29]. It has been found that Cav-1 participates in the process of angiogenesis and is a key regulator of this process [30]. As a result, it has garnered significant attention in tumor and cerebral ischemia research. Given that the biological behavior of embryo implantation resembles that of tumor invasion and metastasis, the successful implantation of an embryo relies on a well-supplied endometrium. Therefore, Cav-1 may become a new target for investigating endometrial angiogenesis. In this study, we found a significant reduction in Cav-1 expression in the endometrium of the PCOS group compared to the control group (Fig. 3E–H). Furthermore, this reduction was positively correlated with the expression of MVD and VEGF (Fig. 5). Recent study has also confirmed that Cav-1 can influence VEGF expression in umbilical vascular endothelial progenitor cells [31]. After Cav-1 gene knockout, the number of VEGF-mediated blood vessels decreased significantly [32]. Collectively, these findings suggest that the decreased expression of Cav-1 in the endometrium during the PCOS implantation window may be an important reason for the decrease in endometrial angiogenesis.

According to research, the chronic inflammatory process plays an important role in the pathogenesis of PCOS [33]. Some inflammatory markers, such as tumor necrosis factor-alpha (TNF- $\alpha{}$ ) [34], nuclear factor kappa-light-chain-enhancer of activated B cells (NF- $\kappa{}$ B) [35] levels increased in PCOS patients. Existing studies have found that inflammatory factors play an important role in promoting angiogenesis in hypoxic tumors and acute and chronic inflammation [36, 37], that low TNF- $\alpha{}$ levels can induce angiogenesis in a variety of tumors [38], and that NF- $\kappa{}$ B can promote angiogenesis and induce disease in various inflammatory areas [37]. Recent studies have shown that obesity is a chronic low-grade inflammatory state. Cav-1 expression is increased in the adipose tissue of obese patients, and it is positively correlated with TNF- $\alpha{}$ and NF- $\kappa{}$ B [33, 34, 39]. However, it is still unclear whether Cav-1 regulates endometrial angiogenesis in the implantation window of PCOS via inflammatory mediators such as TNF- $\alpha{}$ and NF- $\kappa{}$ B and their related mechanisms, which requires further investigation in the future.

5. Conclusions

Our study found that PCOS rats have reduced endometrial angiogenesis during the implantation window. This reduction might be attributed to the decreased Cav-1 expression, indicating that Cav-1 could be a potential therapeutic target for PCOS infertility.

Abbreviations

Cav-1, Caveolin-1; PCOS, polycystic ovary syndrome; SD, Sprague Dawley; MVD, micro-vessel density; IHC, immunohistochemistry; VEGF, vascular endothelial growth factor; DHEA, dehydroepiandrosterone; TNF- $\alpha{}$ , tumor necrosis factor-alpha; NF- $\kappa{}$ B, nuclear factor kappa-light-chain-enhancer of activated B cells.

Availability of Data and Materials

Data are available upon reasonable request.

Author Contributions

HYX contributed to study design, data acquisition, data analysis, and manuscript draft. GZW organized the whole study and rewrote the manuscript. Both authors read and approved the final manuscript. Both authors contributed to editorial changes in the manuscript. Both authors have participated sufficiently in the work and agreed to be accountable for all aspects of the work.

Ethics Approval and Consent to Participate

This study was approved by the Clinical Center Laboratory Animal Welfare & Ethics Committee of Shanghai General Hospital (Ethics approval number: 2021AWS0171).

Acknowledgment

Not applicable.

Funding

This research was supported by the Special Project of Traditional Chinese Medicine Scientific Research of Shanghai Health and Family Planning Commission (2016LP024) and “Xinglin Xinxing” Talent Project of Shanghai [ZY( 2018-2020)-RCPY-3006].

Conflict of Interest

The authors declare no conflict of interest.

References

[1]

Norman RJ, Dewailly D, Legro RS, Hickey TE. Polycystic ovary syndrome. Lancet (London, England). 2007; 370: 685–697.