- Academic Editor
†These authors contributed equally.
Background: Gynecological malignancies, such as endometrial cancer (EC)
and uterine cancer are prevalent. Increased Acyl-CoA synthetase long-chain family
member 1 (ACSL1) activity may contribute to aberrant lipid metabolism, which is a
potential factor that contributes to the pathogenesis of endometrial cancer. This
study aimed to elucidate the potential molecular mechanisms by which ACSL1 is
involved in lipid metabolism in endometrial cancer, providing valuable insights
for targeted therapeutic strategies. Methods: Xenograft mouse models
were used to assess the effect of ACSL1 on the regulation of endometrial cancer
progression. ACSL1 protein levels were assessed via immunohistochemistry and
immunoblotting analysis. To assess the migratory potential of Ishikawa cells,
wound-healing and Transwell invasion assays were performed. Changes in lipids in
serum samples from mice with endometrial cancer xenotransplants were examined in
an untargeted lipidomic study that combined multivariate statistical methods with
liquid chromatography‒mass spectrometry (LC/MS). Results: Patient sample
and tissue microarray data suggested that higher ACSL1 expression is strongly
associated with the malignant progression of EC. Overexpression of ACSL1 enhances
fatty acid
Endometrial cancer (EC) is a typical gynecological malignancy that accounts for
20%–30% of female reproductive tract malignancies and 7%–8% of all
malignancies. The worldwide incidence of EC has grown recently, although the age
of onset has decreased [1]. A previous study showed that lipid metabolism is
closely associated with EC [2]. There is sufficient evidence that obesity is a
substantial risk factor for endothelial dysfunction. Shaw E and colleagues used
body mass index (BMI) as a metric for assessing obesity. Their findings revealed
that obesity, defined as a BMI exceeding 30 and 35 kg/m
Lipid metabolism involves a complex and interconnected network that regulates a variety of processes, including energy metabolism [5], temperature control [6] and the production of signaling molecules [7]. Research has demonstrated that disruption of lipid metabolism can lead to various diseases, including cancer, metabolic disorders, and cardiovascular diseases [8]. In addition to functioning as vital nutrients for the body, fatty acids are also involved in processes related to cell signal transduction and energy metabolism, which support the maintenance of healthy physiological functions. However, uncontrolled fatty acid metabolism can result in excessive lipid biosynthesis and deposition, eventually causing metabolic disorders and even carcinogenesis. Dysregulation of fatty acid metabolism has been implicated in diverse pathologies, including leukemia [9], non-small cell lung cancer, breast cancer [10], and colorectal cancer [11]. Overall, the development of malignancies is significantly influenced by lipid metabolism, particularly fatty acid metabolism. Studies have proposed several mechanisms by which fatty acid metabolism can lead to endometrial carcinogenesis [12]. These pathways mechanisms include mechanisms related to sex steroid hormones [13], insulin resistance [14], and inflammation [15]. Fatty acid oxidation (FAO) is an essential component of fatty acid metabolism. Studies have demonstrated that numerous cancers, such as leukemia [16] and diffuse large B cell lymphoma (DLBCL) [17], rely on FAO as an essential source of ATP [18, 19, 20] that promotes cells survival [21, 22]. Nevertheless, the relationship between FAO and EC as well as the potential related molecular mechanisms are currently unclear and need to be further studied.
An enzyme that participates in the first stage of FAO, namely, Acyl-CoA synthetase long-chain family member 1 (ACSL1), is essential for both lipid production and fatty acid breakdown. Numerous tumor types are characterized by unregulated ACSL1, which justifies the possibility of anticancer therapeutic agents that target this protein. Recent studies have shown that in colorectal cancer, ACSL1 knockdown inhibits cell proliferation and migration, while ACSL1 overexpression can induce epithelial-mesenchymal transition (EMT). Moreover, the increased levels of N-cadherin and Slug indicate that ACSL1 could serve as a direct therapeutic target in colorectal cancer [23]. Furthermore, investigations have suggested that the suppression of ACSL1 can reduce the proliferation, colony formation, and cell viability of breast cancer cell lines, demonstrating that ACSL1 is a desirable target for breast cancer treatment [24]. In summary, ACSL1 represents a promising therapeutic target due to its association with multiple cancer types and its pivotal role in promoting both tumor proliferation and aggressiveness.
According to previous studies, when exogenous long-chain fatty acids reach the
cell, Acyl-CoA synthetase long-chain family member 1 (ACSL1) first activates them
to produce fatty acyl-CoA before they enter downstream metabolic pathways [25].
As adenosine 5
To investigate the connections and potential biological correlations between ACSL1 and the malignant progression of endometrial cancer (EC), we used a combination of molecular biology techniques and lipid metabolite analyses in an isogenic mouse model of EC along with various cell lines. Analysis of patient specimens and tissue microarray findings further supported the finding that ACSL1 expression is increased in EC, and this increased ACSL1 expression is associated with adverse clinical outcomes. Based on these findings, we hypothesize that ACSL1 promotes metastasis and that enhanced proliferation in EC is caused by an increase in FAO via AMPK pathway activation.
Etomoxir (ETX) was purchased from MedChemExpress Chemical Ltd. (Middlesex County, NJ, USA). Rabbit polyclonal antibodies against ACSL1 (cat: DF9605), phosphorylated AMPK (cat: AF3423, phosphorylation site: Thr172), AMPK (cat: AF6423), CPT1C (cat: DF12150), PCNA (cat: AF0239), Ki67 (cat: AF0198), E-cadherin (cat: R868), and vimentin (cat: I444) were purchased from Affinity Biosciences (Changzhou, China). Our lab acquired a rabbit polyclonal antibody against actin (cat: BS6007M) from Bioworld Technology, Inc. (St Louis Park, MN, USA). Takara Biotechnology Co., Ltd. (Beijing, China) provided the PrimeScript RT Reagent Kit and TRIzol®. The Cell-Light EdU Apollo567 In Vitro Kit was obtained from RiboBio Biotechnology Co., Ltd. (Guangzhou, China).
This research was carried out using specimens from 31 female patients (mean age:
55.45
Female BALB/c mice (10–12 g) were obtained from Charles River Co., Ltd.
(Beijing, China) and were housed under conditions of regulated temperature,
humidity, and lighting. Ethical approval for all the animal experiments was
obtained from the Animal Ethics Committee of Xuzhou Medical University, and the
study was conducted in accordance with the principles outlined in the Declaration
of Helsinki. All 24 mice that were used in the study were fed a normal diet.
ACSL1-knockout Ishikawa cells and ACSL1-overexpressing Ishikawa cells were
subcutaneously injected into mice to establish a xenograft tumor model. The mice
were injected with 0.2 mL of a cell suspension (approximately 3
Two hundred microliters of each sample was added to a 1.5 mL centrifuge tube
after all the samples had been carefully thawed on ice and vortexed to mix them.
Subsequently, 200 µL of water was added, followed by the sequential
addition of 240 µL of precooled methanol and 800 µL of MTBE. The
solutions were agitated, subjected to 20 minutes of sonication in a chilled water
bath, and subsequently incubated at room temperature for 30 minutes. The samples
were then centrifuged at 14,000
A UHPLC Nexera LC-30A system for ultra-highperformance liquid chromatography (UHPLC)
(Waters, Wilmslow, UK) was used for all chromatographic separations. For
separation, an ACQUITY UPLC CSH C18 column (100 mm
After separation with UHPLC, samples were analyzed using a QExactive Plus mass spectrometer. Via electrospray ionization (ESI) and positive ion mode, QExactive Plus was used for detection. In positive ion mode, the capillary temperature was maintained at 350 °C, and the spray voltage was set to 3.0 kV. In negative ion mode, the capillary temperature was maintained at 350 °C, while the spray voltage was set to 2.5 kV. The positive MS1 scan ranges were 200 to 1800 and 250 to 1800 in negative mode.
The cell lines underwent authentication, which included assessments of
morphology, antigen expression, growth characteristics, DNA profiles, and
cytogenetic analyses, and these analyses were performed by the provider. Ishikawa
cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum
(Clark, NV, USA), 1% penicillin, and 1% streptomycin. The cells were maintained in
a controlled environment at 37 °C with 95% humidity and 5% CO
The lentiviral vector containing green fluorescent protein (GFP) was supplied by
Genechem (Shanghai, China). The lentiviral vector system carrying the /textitGV gene
consists of a series of GV lentiviral vectors, the pHelper 1.0 vector and the
pHelper 2.0 vector. Small interfering RNAs (siRNAs) targeting the human
ACSL1 gene were designed and provided by Shanghai GeneChem Co., Ltd., China.
After screening with Lipofectamine 2000 (Invitrogen Corporation, Carlsbad, CA,
USA) and cotransfection of a plasmid carrying human ACSL1 (NM_001995) cDNA into
HEK293T cells in six-well plates, the optimal siRNA sequence
(5
Cells were seeded in a 96-well plate at a density of 5000 cells per well. After 24 hours of incubation, 10 µL of CCK8 solution (Dojindo Laboratories, Kumamoto, Japan) per well was added to 96-well plates and incubated for 1 hour. The culture medium was replaced with FBS-free high-glucose DMEM in the dark. The cells were then incubated at room temperature for 37 °C, and the optical density(OD) values at 450 nm were measured.
Ishikawa cells were seeded in 96-well plates at a density of 4
Ishikawa cells were plated in six-well plates and grown to 90% confluence. A
scratch was generated in the cell monolayer using a sterile 10-L pipette tip,
which led to the development of a wound. The progression of wound healing was
recorded at a magnification of 200
Ishikawa cells (1
Each well of a 96-well microplate was seeded with 100 µL of a cell suspension, followed by the addition of 50 µL of mammalian cell lysis solution before the cells were plated. The microplate was subjected to agitation at 700 rpm for five minutes using an orbital shaker. ATP was stabilized, and the cells were lysed. After adding 50 µL of substrate solution to the wells, the microplate was agitated at 700 rpm for five minutes using an orbital shaker, and after ten minutes of adaptation to the dark, the brightness of the plate was measured. ATP levels were measured using the ATP LITE Assay Kit (PerkinElmer, Waltham, MA, USA) according to the manufacturer’s guidelines.
Cells from different groups were seeded at a density of 1
Ishikawa cells were cultured in XF96 plates and subjected to a 48-hour treatment
with 50 µM etomoxir (ETX), which inhibits FAO. The original cell culture medium (in a pH 7.4 environment, the culture
medium contained 1640 media with 10 mM glucose, 1 mM sodium pyruvate, and 2 mM
glutamine) was replaced with the test solution after the tissues had been
incubated for 1 h at 37 °C without CO
Tumor specimens were preserved in 10% phosphate-buffered formalin, followed by paraffin embedding. Thin paraffin sections (2–3 µm) were subjected to staining, including periodic acid-Schiff (PAS) and Masson’s trichrome staining.
Paraffin-embedded xenograft tissue sections (4 µm) were deparaffinized and gradually rehydrated through a gradient of ethanol solutions. Antigen retrieval was conducted by boiling the samples in citrate buffer (0.01 M, pH 6.0) for 15 minutes. The tissue sections were treated for 10 minutes with 3% hydrogen peroxide and then blocked with goat serum for 30 minutes. Specific primary antibodies against ACSL1 (Affinity, 1:100), PCNA (Affinity, 1:100), and Ki67 (Affinity, 1:100, ready to use) were then applied to the sections. Immunohistochemical staining was conducted in accordance with the manufacturer’s guidelines utilizing the DAB method (GSK500710, Gene Tech, China).
In our experimental procedure, total tissue RNA was isolated with TRIzol® (Invitrogen), ensuring the highest quality RNA extraction. Subsequently, cDNA synthesis was performed utilizing the PrimeScript RT Reagent Kit from TaKaRa Biotechnology Co., Ltd. according to the manufacturer’s recommendations, ensuring the reliability of the process. To accurately quantify mRNA expression, real-time quantitative reverse transcriptase PCR analysis was performed using the LightCycler® 480 II system from Roche, Switzerland. This platform followed to established protocols, guaranteeing the robustness and reproducibility of our results. For the complete list of primer sequences that were used in our study, please refer to Table 1.
Genes | Sequence |
ACSL1 | ACTCTTCCGACCAACACGCTTATG |
ACCACCACTACCCGCCACTTC | |
GCAAAGACCTGTACGCCAAC | |
AGTACTTGCGCTCAGGAGGA |
Total protein was extracted using ice-cold RIPA buffer, and insoluble fractions
were subsequently removed from the samples. The protein concentration was
quantified via bicinchoninic acid (BCA) assay. The main antibodies included antibodies against ACSL1
(Affinity, 1:1000), phosphorylated AMPK (Affinity, 1:1000), AMPK (Affinity,
1:1000), CPT1C (Affinity, 1:1000) and
We conducted quantitative analyses of all our experimental results using SPSS
Statistics 16.0 software (SPSS Inc, Chicago, IL, USA). Experimental data are
presented as the mean
Considering the pivotal role of ACSL1 in modulating the biosynthesis of diverse acyl-CoAs, we sought to investigate whether ACSL1 is involved in endometrial tumorigenesis. Thus, we initially conducted immunohistochemical (IHC) staining of specimens from 6 endometrial cancer patients and their adjacent normal tissues. We scored the levels of ACSL1 expression based on the intensity of ACSL1 staining. The IHC scores for ACSL1 expression were significantly higher in endometrial cancer tumor tissues than in noncancerous tissues (Fig. 1A). After observing an increase in ACSL1 levels within tissues, we subsequently investigated whether its levels were increased in the serum of endometrial cancer patients. Serum ACSL1 levels serve as a potential circulating biomarker that indicates systemic changes that are associated with observed tissue alterations. This approach provides insights into the systemic implications of the observed tissue changes (Fig. 1B). In addition, Fig. 1C,D show that the protein and mRNA levels of ACSL1 were aberrantly upregulated in endometrial tissue from EC patients. The levels of PCNA and Ki67 (proliferation markers) in tumor tissues were significantly higher than those in adjacent normal tissues. In contrast to adjacent normal tissues, tumor tissues exhibited reduced E-cadherin and elevated vimentin expression, which indicated EMT (Fig. 1E). Therefore, we propose that ACSL1 is involved in the proliferation and migration of EC. Collectively, these findings indicate that increased ACSL1 expression is associated with endometrial cancer, suggesting that it has a potential oncogenic role.
ACSL1 expression in healthy individuals and endometrial cancer
patients. (A) Representative immunohistochemistry (IHC) images and scatter plot
of ACSL1 protein expression in endometrial cancer tissueand adjacent normal
tissues (N group: n = 6, EC group: n = 16). IOD stands for “Integrated Optical
Density”. In immunohistochemistry studies, IOD quantifies staining results,
reflecting the total amount of stained substance. Scale bar: 20 µm.
EC group represents endometrial cancer patients and their adjacent normal tissues represent N group. (B) Serum ACSL1 levels in healthy subjects and endometrial cancer patients (N
group: n = 18, EC group: n = 18). (C) Representative Western blot and bar chart
showing the quantification of ACSL1 expression in endometrial cancer tissues (EC)
and para-cancerous tissues (N). (D) The mRNA expression of ACSL1 in endometrial
tissues from endometrial cancer tissues (EC) and para-cancerous tissues (N). (E)
Representative immunohistochemistry (IHC) images and scatter plot of Ki67, PCNA,
vimentin, and E-cadherin in endometrial cancer tissueand adjacent normal tissues
(N group: n = 6, EC group: n = 6). Scale bar: 20 µm. Data are
presented as the mean
Considering that ACSL1 is elevated in endometrial cancer, we wondered whether ACSL1 promotes endometrial cancer cell proliferation and migration, and we established ACSL1-knockdown (SI) and ACSL1-overexpressing (OE) Ishikawa cell lines by lentiviral infection. Western blotting confirmed high knockdown efficiency in IK cells, which were subsequently selected for further experiments (Fig. 2A).
The proliferation and migratory potential of EC cells were
assessed. (A) Western blotting validated the of ACSL1 gene overexpression and
knockout in subsequent experiments. (B,C) The proliferation of Ishikawa cells was
assessed by EdU assays and CCK-8. Scale bar, 100 µm. (D)
Wound-healing assay was used to assess Ishikawa cell migration. Scale bar: 200
µm. (E) The migration of abilities of Ishikawa cells was determined
by migration assay Scale bar, 100 µm. The data are presented as the
mean
Cell proliferation was assessed via EdU assays and the CCK-8 method. The findings indicate that the upregulation of ACSL1 resulted in a higher fold increase in the percentage of EdU-positive cells, while ACSL1 knockdown resulted in a lower fraction of EdU-positive cells (Fig. 2B). Moreover, ACSL1 overexpression promoted Ishikawa cell proliferation, whereas ACSL1 knockdown inhibited cell proliferation (Fig. 2C). To delve deeper into the impact of ACSL1 on cell invasion, we conducted wound healing and Transwell assays. Ishikawa cell migration was significantly decreased in the ACSL1-overexpressing (SI) group in comparison to the control (SI-NC) group (Fig. 2D). The OE group exhibited increased cell invasion, whereas the SI group exhibited decreased cell invasion (Fig. 2E).
Previous studies have revealed that ACSL1 can enhance lipid metabolism, and it is noteworthy that the progression of cancer is intricately associated with alterations in lipid metabolism [28]. Therefore, to investigate whether ACSL1 affects the progression of EC through lipid metabolism, we generated a xenograft mouse model and then carried out lipidomic profiling using the serum of EC mice from the SI group and NC group (SI group: ACSL1 knockdown group; NC group: ACSL1 knockdown negative control group). In the xenograft model, EC cells were infected with ACSL1 silencing or negative control lentivirus before injection.
The volcano plot visually represents the overall fold change in lipid molecules
between the SI and SI-NC groups, with magenta points denoting lipids that met the
criteria for differential expression [fold change (FC)
ACSL1 overexpression is associated with lipid metabolism
disorders in endometrial cancer. (A) Volcano plot analysis was performed to
identify lipid species that exhibited significant changes in relative abundance
in the xenograft mouse model. Each point on the plot represents a lipid molecule.
The magenta area represents molecules that met the criteria for being
differentially expressed [fold change
Subsequently, we assessed the MDA and ATP levels. Malondialdehyde (MDA) is a common metabolic byproduct of lipid peroxidation and is frequently utilized as a quantitative marker for assessing the extent of lipid oxidation. MDA contents serve as an indicator for evaluating lipid metabolism and oxidative lipid levels. The results are shown in Fig. 3C,D. ACSL1 increased FAO and ATP production in EC cells. These findings strongly indicate that ACSL1 modulates EC cell energy metabolism by regulating lipid metabolism.
To elucidate the molecular mechanisms underlying the role of ACSL1 and the pivotal role of FAO in EC progression, we used EC (Ishikawa) cells, including control cells (OE-NC) and ACSL1-overexpressing cells (OE); we treated these cells with ETX (inhibits the CPT1C protein) to suppress FAO. The CPT1C protein is a key enzyme in FAO.
As shown in Fig. 4A–D, ACSL1 overexpression increased FAO, induced ATP production, and enhanced cell proliferation and migration. These effects were inhibited after the administration of ETX and restored with the upregulation of ACSL1. When ACSL1 was overexpressed, EC cells showed higher basal and maximum respiratory capacity (Supplementary Fig. 1), with increased intracellular ATP levels (Supplementary Fig. 1). Moreover, ACSL1 upregulation partially attenuated the ability of ETX to suppress FAO.
Increased ACSL1 expression promotes EC by regulating the fatty acid oxidation (FAO) metabolism pathway. (A) Ishikawa cell proliferation was assessed with CCK-8.
Scale bar: 100 µm. (B) Ishikawa cell migration was assessed via
wound healing assay. Scale bar: 100 µm. (C) MDA level. (D) OCR value
of cells. (E) ATP level. (F) Representative Western blot and quantitative bar
chart illustrating ACSL1, p-AMPK, and CPT1C protein expression in Ishikawa cells.
(G) Representative Western blot and quantitative bar chart illustrating ACSL1,
p-AMPK, and CPT1C protein expression in ACSL1-overexpressing IK cells after 48
hours of treatment with 50 µM etomoxir. Data are presented as the
mean
Research has shown that ACSL1 can modulate AMPK activity [26] and its downstream target, CPT1C, subsequently influencing FAO [27, 29, 30]. Therefore, the protein expression of ACSL1, p-AMPK, AMPK and CPT1C was measured in this study. The findings indicated a significant upregulation of these proteins after ACSL1 overexpression (Fig. 4F). These results demonstrated that ACSL1 was aberrantly expressed in EC and could further promote the proliferation and migration of EC cells via the AMPK/CPT1C/ATP pathway.
After ETX treatment, the expression of ACSL1 and p-AMPK/AMPK was unaffected; however, CPT1C was significantly downregulated. Furthermore, the overexpression of ACSL1 reversed the inhibitory effect of ETX, which led to the upregulation of CPT1C, suggesting that ACSL1 was indeed associated with the FAO-induced progression of EC (Fig. 4G). Overall, these experiments showed that ACSL1 indeed induced FAO, effectively promoting EC growth and potentially stimulating metastasis.
To explore the association of ACSL1 with EC malignancy, ACSL1-knockdown and ACSL1-overexpressing xenograft model mice were established. As shown in Fig. 5A,C, ACSL1 dramatically increased the size and promoted the growth of the tumors. More information about the tumors is shown in Fig. 5B. According to the results of H&E staining of tumor tissues (Fig. 5D), compared with the cells of the other groups, the cells of the OE group displayed a denser composition with an intact envelope, while the dioscin-treated group exhibited a looser texture with an incomplete envelope. Additionally, the central necrotic region was expanded, accompanied by inflammatory cell infiltration.
ACSL1 promotes tumorigenicity in an EC xenograft model. (A)
Representative images of mouse tumor tissue. (B) Tumor information (tumor volume:
a
Next, immunohistochemical staining experiments were conducted on mouse tumor tissues. We scored the expression levels of PCNA and Ki67 based on the staining intensity. In the ACSL1-overexpressing tumor tissues, IHC scores for PCNA and Ki67 were significantly higher than those of the other groups (Fig. 5D). Subsequently, we examined the expression of ACSL1, p-AMPK and CPT1C in the xenografts by Western blotting. The findings demonstrated that the xenografts derived from ACSL1-knockdown cells exhibited significantly decreased expression of ACSL1, p-AMPK and CPT1C. Conversely, the OE group reversed this phenomenon (Fig. 5E). Overall, we propose that ACSL1 could facilitate the malignant phenotype of EC.
Endometrial cancer is a common gynecological condition that always occurs in perimenopausal and postmenopausal women. Fatty acid metabolism was previously implicated in cancer progression [31]. Kristin M. Nieman and colleagues suggested that adipocytes serve as a source of fatty acids that promote accelerated tumor growth. This finding identified fatty acid metabolism and transport as emerging therapeutic targets in cancers with crucial adipocyte involvement [20]. As tumors progress, cancer cells are often exposed to harsh environmental conditions, including a deficiency in essential fatty acid supply. Hence, cancer cells use a biological mechanism to overcome this challenge in growth and metastasis.
ACSL1, which is abundant in adipose tissue, liver, and heart, exhibits broad fatty acid substrate specificity [32]. The association between ACSL1 dysregulation and cancer progression has been documented. For instance, upregulation of ACSL1 is implicated in colorectal cancer pathogenesis [24]. Significantly, increased ACSL1 expression in patient tumor samples predicts poor prognosis [24]. Elevated ACSL expression in breast cancer subtypes (ER-negative, ER-positive, and HER2-positive) is correlated with reduced patient survival [33, 34]. To validate the potential diagnostic utility of ACSL1, we assessed gene expression in clinical samples from 64 subjects. Our data revealed a significant increase in ACSL1 levels in EC patients compared to healthy volunteers. We assessed 58 human samples, including serum and tissue samples, and the results were highly consistent (Fig. 1A–D).
However, although Guo L et al. [35] found a link between ACSL1 and thyroid cancer progression and migration, it is unknown whether ACSL1 induces EC by promoting its progression and migration. Our data demonstrated that proliferation and migration indices were increased in clinical EC tissue samples (Fig. 1E). In addition, the upregulation of ACSL1 was able to promote the proliferation and migration of EC cells (Fig. 2). These results indicated that increased ACSL1 expression levels were associated with proliferation and migration in human EC. Furthermore, in xenograft mice, our data confirmed the role of ACSL1 in EC, demonstrating that ACSL1 is an important participant in cancer growth and metastasis (Fig. 5).
ACSL1 is closely associated with fatty acid metabolism [36]. Ming Cui et al. [37] suggested that an imbalance of ACSL1 could facilitate the malignant progression of hepatoma cells via disordered fatty acid metabolism. Our results in xenograft mice also corroborated this finding, which was consistent with the function of ACSL1 in fatty acid metabolism (Fig. 3A,B). Furthermore, ACSL1 plays a pivotal role in inducing FAO [38]. Our findings confirm that elevated ACSL1 expression, as observed during metabolic reprogramming, enhances FAO and ATP production (Fig. 3C,D). This heightened FAO increases cancer cell energy reserves, protecting them against reactive oxygen species during metastasis [18].
Long-chain acyl-CoAs have diverse metabolic outcomes and can be converted to
acylcarnitine for
It is essential to acknowledge several limitations in our study. First, the classification of the tumor tissues that were included in this study lacks specificity, as distinct subtypes of endometrial cancer were not clearly delineated. The analysis did not separately analyze tumor tissues from different stages and subtypes of endometrial cancer. This limitation should be considered when interpreting the findings of our study. Furthermore, our study reveals a close association between ACSL1 and the occurrence and progression of endometrial cancer. However, based on the analysis of the human protein atlas (http://www.proteinatlas.org/ENSG00000151726-ACSL1/pathology/endometrial+cancer), we cannot conclusively establish ACSL1 as a prognostic factor for endometrial cancer. This outcome underscores the consideration of ACSL1 as a potential modulator influencing the onset and development of endometrial cancer. In the quest for prognostic factors associated with this malignancy, further exploration is warranted in future research endeavors.
In this study, we elucidated the upregulation of ACSL1 expression in endometrial cancer (EC) cells, animal models, and clinical specimens, and presented pioneering evidence that ACSL1 drives EC progression by regulating the AMPK/CPT1C/ATP signaling pathway. The exploration of the potential biological correlation between FAO and the malignant progression of EC has emerged as a highly relevant avenue for scientific inquiry. Our findings emphasize the pivotal role of ACSL1 in the malignant progression and metastatic dissemination of EC, highlighting the potential effectiveness of targeting ACSL1 in this context.
In conclusion, our research findings indicate that ACSL1 activates the AMPK/CPT1C/ATP pathway, thereby inducing fatty acid oxidation and promoting proliferation and migration, ultimately resulting in the malignant progression of endometrial cancer.
ACC, Acetyl-CoA carboxylase; ACSL1, Acyl-CoA synthetase long-chain family member
1; AMP, Adenosine 5
All the data that were generated or analyzed during this study are included in this published article.
Formal analysis was performed by YZ, YYL, GFC, XG, YXX, XLG and JM; Methodology was designed by NZ and BZ; Resources were handled by BZ and XYZ; study concept and design was provided by XYZ; Writing—original draft was done by YZ and YYL; Writing—review and editing was done by XYZ and BZ. All authors contributed to editorial changes in the manuscript. All authors read and approved the final manuscript. All authors have participated sufficiently in the work and agreed to be accountable for all aspects of the work.
The study was approved by the Biomedical Research Ethics Review Committee of Xuzhou Central Hospital and was in accordance with the Declaration of Helsinki (approval number, XZXY-LK-20210901-025; date, 1 September, 2021). The animal study was conducted with the approval of and in accordance with the rules and regulations of the Institutional Animal Care and Use Committee in Xuzhou Medical University, Xuzhou, China (approval number, 202103A168; date, 19 March 2021). Each participant provided their written agreement in advance of the investigation.
We thank the core facilities of the Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy.
This study was supported by the Natural Science Foundation of China (No. 82173883, China); the Science and Technology Foundation of Xuzhou (No. KC21010, China); the Natural Science Foundation of the Jiangsu Higher Education Institutions of China (No. 18KA350002, China); the Provincial Commission of Health and Family Planning in Jiangsu Province (No. H2017079, China) and the Science and Technology Planning Project of Jiangsu Province (No. BE2019636, China).
The authors declare no conflict of interest.
Publisher’s Note: IMR Press stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.