- Academic Editor
Background: Heliox shows protective effects against
acute focal ischemia-reperfusion injury in the brain. However, further research
is needed to unveil the intricate molecular mechanisms involved. Determining how
heliox affects ferroptosis caused by oxygen-glucose deprivation/reoxygenation
(OGD/R) in SH-SY5Y cells as well as the underlying mechanism was the goal of the
current work. Methods: With the use of
2
Ischemia/reperfusion (IR) occurs in several diseases and involves the two processes of ischemia and reperfusion [1]. Ischemia is linked to metabolic imbalance and cell hypoxia, while reperfusion, or reoxygenation of the ischemic area, induces an inflammatory response leading to tissue deterioration [2]. IR injury often occurs during this period and hinders patient recovery, although the mechanism of injury remains unclear. To manage IR injury, however, suppression of cell death has the potential to be a successful therapeutic approach.
Cell death encompasses necrosis, apoptosis, autophagy, and ferroptosis, and is essential to the pathogenesis of IR [3, 4, 5]. The two main types of cell death in IR injury are caspase-dependent apoptosis and necroptosis that is dependent on the activation of serine/threonine kinase-3 [6]. Although autophagy can maintain cell health, excessive autophagic activity during IR injury can induce neuronal death [6, 7]. Ferroptosis characterized by severe lipid peroxidation and plasma membrane rupture, is another type of programmed cell death [8]. Ferroptosis-associated cellular events, including increased iron levels and lipid peroxidation, have been observed during IR injury [9, 10, 11]. Hence, this form of cell death could serve as a potential therapeutic target.
Heliox has been used in respiratory medicine for decades [12, 13]. It is produced by replacing nitrogen in the air (~78%) with helium, and supplementing with 21% oxygen. The density of heliox is one-third that of normal air density [14]. Furthermore, heliox preconditioning has been shown to have a neuroprotective effect by upregulating anti-oxidases and inhibiting necroptosis [15]. However, the specific processes underlying heliox’s protection against IR damage as well as its potential link to ferroptosis are still not fully understood.
In the current study, an oxygen-glucose deprivation/reoxygenation (OGD/R) procedure was used to produce a cellular model of IR injury in the SH-SY5Y cell, a human neuroblastoma cell line. OGD/R-induced ferroptosis in these cells was then investigated using several techniques. Specifically, heliox produced a significant protective effect against OGD/R-induced ferroptosis in SH-SY5Y cells by activating the phosphatidylinositol 3-kinase/protein kinase B (PI3K/AKT) pathway.
SH-SY5Y cells (IM-H227) which had been tested and validated for
mycoplasma (See Supplementary Material) were purchased from Xiamen IMMOCELL
Biotechnology Co., Ltd. (Xiamen, China) and cultured in 45% Dulbecco’s modified
eagle’s medium (DMEM; 11965092, GIBCO, New York, NY, USA) and 45% Ham’s F12
medium (11765054, GIBCO) with 10% fetal bovine serum (FBS;
10099141C, GIBCO) in an incubator at 37 °C and with 5% CO
When the SH-SY5Y cell density reached 70–80%, cells were washed three times
using phosphate buffered solution (PBS) to completely remove the medium and then
cultured in 50% glucose-free DMEM (11966025, GIBCO) and 50% Ham’s F12 medium in
an incubator at 37 °C for 4 h with 95% N
Medium (100 µL) containing 1
SH-SY5Y cells were lysed on ice in radioimmunoprecipitation assay (RIPA, catalog number: E-BC-R327, Elabscience, Wuhan, Hubei, China) buffer
for 20 min. Centrifugation at 15,000
Following OGD/R or heliox treatment, reactive oxygen species (ROS) levels in
SH-SY5Y cells were assessed using the 10 µM
2
After treatment under different conditions, the JC-1 probe (C2006, Beyotime Biotechnology) was used to determine mitochondrial membrane potential (MMP) in SH-SY5Y cells for 20 min at 37 °C in an incubator. PBS was used to wash the cells twice and flow cytometry was used to measure the fluorescence signals from SH-SY5Y cells.
The RNA, separated from SH-SY5Y cells using TRIzol reagent (Invitrogen, Waltham,
MA, USA), was used for cDNA synthesis using a reverse transcription kit (R323-01,
Vazyme, Nanjing, Jiangsu, China). The SYBR Master Mix (Q411-02, Vazyme) was used to carry
out the quantitative polymerase chain reaction (qPCR). Each sample was analyzed
in triplicate on an Applied Biosystems
Gene | Forward primer (5 |
Reverse primer (5 |
ACSL4 | GCTATCTCCTCAGACACACCGA | AGGTGCTCCAACTCTGCCAGTA |
COX2 | CGGTGAAACTCTGGCTAGACAG | GCAAACCGTAGATGCTCAGGGA |
FTH1 | TGAAGCTGCAGAACCAACGAGG | GCACACTCCATTGCATTCAGCC |
GPX4 | ACAAGAACGGCTGCGTGGTGAA | GCCACACACTTGTGGAGCTAGA |
SLC7A11 | TCCTGCTTTGGCTCCATGAACG | AGAGGAGTGTGCTTGCGGACAT |
18S | CGACGACCCATTCGAACGTCT | CTCTCCGGAATCGAACCCTGA |
PI3K | GAAGCACCTGAATAGGCAAGTCG | GAGCATCCATGAAATCTGGTCGC |
AKT | TGGACTACCTGCACTCGGAGAA | GTGCCGCAAAAGGTCTTCATGG |
qPCR, quantitative polymerase chain reaction; COX2, cyclooxygenase-2; FTH1, ferritin heavy chain 1; GPX4, glutathione peroxidase 4; PI3K, phosphatidylinositol 3-kinase; AKT, protein kinase B.
Following treatment under different conditions, SH-SY5Y cells were lysed by incubation on ice for 20 min in RIPA buffer containing phosphatase inhibitor. A bicinchoninic acid (BCA) kit (PA115-02; TIANGEN Biotechnology, Beijing, China) was used to extract proteins and measure their concentration. Equal protein amounts were loaded into the wells of a 10% sodium dodecyl sulfate-polyacrylamide (SDS-PAGE) gel. Electrophoresis was carried out at 80 V for 0.5 h and at 120 V for 1 h. At 350 mA for 3 h, the isolated proteins were deposited onto polyvinylidene fluoride membranes. Five percent non-fat milk was used to inhibit the membranes for 1 h. After being exposed to primary antibodies overnight at 4 °C, the membranes were incubated with secondary antibody for 1 h at 25 °C. An enhanced chemiluminescence kit (WP20005, Thermo Fisher Scientific) was used to detect the protein bands, which were imaged using a Bio-Rad ChemiDoc MP imaging system (catalog number: 12003154, Bio-Rad, Hercules, CA, USA). All antibodies used are listed in Table 2.
Classification | Antibodies | Manufacturer, city, state, country | Catalog number | Dilution |
Primary antibody | SLC7A11 | Proteintech, Wuhan, China | 26864-1-AP | 1:3000 |
COX2 | Proteintech, Wuhan, China | 66351-1-Ig | 1:3000 | |
ACSL4 | Proteintech, Wuhan, China | 22401-1-AP | 1:3000 | |
FTH1 | Abcam, Shanghai, China | ab183781 | 1:3000 | |
GPX4 | Proteintech, Wuhan, China | 67763-1-Ig | 1:3000 | |
GAPDH | Proteintech, Wuhan, China | 60004-1-Ig | 1:5000 | |
P-PI3K | Cell Signaling technology, Boston, MA, USA | 17366 | 1:3000 | |
PI3K | Proteintech, Wuhan, China | 20584-1-AP | 1:3000 | |
P-AKT | Proteintech, Wuhan, China | 80455-1-RR | 1:3000 | |
AKT | Proteintech, Wuhan, China | 60203-2-Ig | 1:3000 | |
P-p65 | Abcam, Shanghai, China | ab76302 | 1:3000 | |
P65 | Proteintech, Wuhan, China | 80979-1-RR | 1:3000 | |
P-p50 | Abcam, Shanghai, China | Ab28849 | 1:3000 | |
Secondary antibody | HRP-conjugated goat anti-rabbit IgG | Proteintech, Wuhan, China | SA00001-2 | 1:10,000 |
HRP-conjugated goat anti-mouse IgG | Proteintech, Wuhan, China | SA00001-1 | 1:10,000 |
HRP, horse radish peroxidase; FTH, ferritin heavy chain.
The creation of bar charts and statistical analysis were performed using
GraphPad Prism (version 8.0, GraphPad Software, Inc., San
Diego, CA, USA). Student’s t-test (unpaired) and one-way analysis of
variance (ANOVA) were used to compare parametric data between
two groups and among multiple groups, respectively. Western blots were scanned
and the signal intensity was quantified using ImageJ (version 2, National
Institutes of Health, Bethesda, MD, USA). Statistical significance was
determined at the following probability levels: *p
To examine the effect of heliox on IR injury, oxygen-glucose deprivation (OGD) was initially applied for 4 h to SH-SY5Y cells which were followed by incubation with oxygen and glucose for 0, 3, 6, 12, or 24 h. Using the MTT assay, a significant reduction in the SH-SY5Y cells’ survival was observed following treatment with oxygen and glucose for 3, 6, 12, and 24 h (Fig. 1A). DCFH-DA staining and flow cytometry were performed to investigate ROS production after OGD/R treatment. The peak shifted to the right (Fig. 1B), indicating the mean fluorescence intensity (MFI) of DCFH-DA increased after reoxygenation for 3, 6, 12, and 24 h. As shown in Fig. 1C, ROS levels in SH-SY5Y cells treated with OGD/R also increased significantly. The JC-1 probe was used to investigate whether OGD/R treatment altered the MMP. As shown in Fig. 1D, OGD/R treatment of SH-SY5Y cells resulted in a noticeable increase in the proportion of cells displaying green fluorescence. The green/red ratio increased significantly with longer treatment times (Fig. 1E). OGD/R therefore decreased the survival and MMP of SH-SY5Y cells, and increased the production of ROS.
OGD/R prevents SH-SY5Y cells from surviving. 4-h OGD exposure
was applied to SH-SY5Y cells, which were followed by treatment with
oxygen-glucose for 0, 3, 6, 12, or 24 h. Cell survival was then evaluated using
the MTT assay (A); the DCFH-DA dye was used to gauge ROS generation (B); the
relative mean fluorescence intensity (MFI) of the DCFH-DA probe was quantified
(C); the MMP was determined using JC-1 dye and flow cytometry (D); and the MFI of
JC-1 fluorescence was quantified (E). OGD denotes oxygen-glucose deprivation, and
R represents reoxygenation. IR, ischemia/reperfusion; OGD, oxygen-glucose deprivation; OGD/R,
oxygen-glucose deprivation/reoxygenation; MTT, methyl thiazolyl tetrazolium; DCFH-DA, 2
High ROS production occurs when cells undergo ferroptosis [16]. The above
results indicate that OGD/R induces a large amount of ROS production in SH-SY5Y
cells, suggesting that it may inhibit cell survival by inducing ferroptosis. In
addition, heliox has been shown to protect the brain from acute focal IR injury
[17]. To investigate the molecular mechanism by which heliox protects the brain,
we therefore studied its role in ferroptosis. OGD/R-treated SH-SY5Y cells were
cultured with helium and oxygen for 0, 12, or 24 h. Untreated cells acted as the
controls. The ischemia reperfusion/helium-oxygen mixture (IR/HOM) 0 h group were
cells that were cultured for 4 h under OGD and then for 6 h in 5% CO
Heliox protects OGD/R-treated SH-SY5Y cells from
ferroptosis. OGD was
applied to SH-SY5Y cells for 4 h, followed by heliox-glucose therapy for 0, 12,
or 24 h. Assessments were then made of the mRNA (A) and protein levels (B,C) for
COX2, ACSL4, FTH1, SLC7A11, and GPX4 using qPCR and immunoblotting, respectively.
Commercial kits were used to measure MDA, GSH, GSSG, and Fe
The PI3K/AKT pathway is known to play a crucial role in regulating cell
proliferation [19]. Experiments were therefore conducted to evaluate the
expression of proteins involved in the PI3K/AKT pathway following heliox
treatment. Heliox treatment markedly upregulated the expression levels of
phosphorylated PI3K and phosphorylated AKT in OGD/R-treated SH-SY5Y cells (Fig. 3A,B). Moreover, the mRNA levels of PI3K and AKT decreased
after OGD/R exposure, but increased after heliox treatment (Fig. 3C). The levels
of p50 and phosphorylated p65 were markedly increased in OGD/R-treated SH-SY5Y
cells, but decreased significantly following heliox treatment (Fig. 3A,B). These
findings suggest that heliox treatment effectively suppresses the nuclear factor-
Heliox therapy stimulates the PI3K/AKT pathway while impairing
the NF-κB pathway in OGD-treated SH-SY5Y cells. OGD was applied to SH-SY5Y cells
for 4 h, and then heliox-glucose was applied for 0, 12, or 24 h. The protein levels for P-PI3K, PI3K, P-AKT, AKT, P-p65, p65, p50, and
GAPDH were then measured using immunoblotting (A,B), while the mRNA levels for
PI3K and AKT were quantified using qPCR (C). ns, not
significant. **p
After heliox administration for 24 h, we introduced the AKT inhibitor MK-2206 to
OGD/R-treated SH-SY5Y cells to test if heliox exerts its protective effect via
activation of the PI3K/AKT pathway. MK-2206 treatment significantly reduced the
protein levels of phosphorylated AKT, SLC7A11, and GPX4 in heliox-treated SH-SY5Y
cells (Fig. 4A,B). The decrease in MDA, GSSG, and Fe
Heliox protects SH-SY5Y cells from ferroptosis via triggering
the PI3K/AKT pathway. After oxygen-glucose deprivation for 4 h, SH-SY5Y
cells were treated with heliox-glucose and MK-2206 for 0 or 24 h. The following
assessments were then made: protein levels for P-PI3K, PI3K, P-AKT, AKT, SLC7A11,
and GPX4 using immunoblotting (A,B); levels of MDA, GSH, GSSG, and
Fe
IR injury elicits a wide range of cellular and molecular responses within the brain, highlighting its significant pathological impact. To date, there are no effective therapies for the treatment of cerebral IR injury [20]. Experimental OGD/R treatment has been widely used to mimic IR injury [21]. The SH-SY5Y cell line is the most widely used model to investigate neuronal function [22, 23, 24, 25, 26]. By administering OGD/R to SH-SY5Y cells, we therefore created a cellular model of IR injury. In contrast to previous studies, the current investigation focused on the role of ferroptosis in OGD/R-treated SH-SY5Y cells.
OGD can cause SH-SY5Y cell death and increase intracellular ROS production [26]. In support of this, we also found that OGDs can induce ferroptosis and increase ROS production in SH-SY5Y cells. Other studies have shown that OGD leads to lower cellular expression of ferritin heavy chain (FTH) [27, 28]. However, we found that FTH expression increased in OGD-treated SH-SY5Y cells. Increased FTH was also reported in hippocampal neurons treated with 0.5 µM erastin [29]. Ferritin plays an antioxidant role in cells by isolating redox-active iron [30]. During ferroptosis, nuclear receptor coactivator 4-mediated ferritin autophagy produces a large amount of ferrous ion and consumes large amounts of ferritin [31]. The resulting cellular imbalance may activate protective mechanisms to replenish ferritin; we therefore speculate that the up-regulation of FTH may be a compensatory mechanism for iron homeostasis. However, it might also instigate a chain reaction that results in cell death. These conjectures need further investigation.
There is increasing evidence that ferroptosis is halted when the PI3K-AKT
pathway is activated. In SH-SY5Y cells, OGD reduced activity in the PI3K-AKT
pathway, while heliox reversed this inhibition, thus reducing cell damage caused
by OGD. Moreover, the NF-
The current study had some limitations. Although we confirmed that blocking of
the NF-
In summary, the current findings demonstrate that OGD/R in SH-SY5Y cells induces ferroptosis, enhances ROS levels, promotes lipid peroxidation, and diminishes antioxidant capacity. Heliox treatment can, however, effectively reverse these effects by activating the PI3K/AKT pathway. These findings suggest that heliox could be a promising innovative therapeutic approach for the treatment of IR injury.
The data that support the findings of this study are available within the article.
SY and WX designed the research study. SY, WX, WJX, and YFC performed the experiments. SY, WX and WJX analyzed the data. SY and WJX drafted the manuscript. All authors contributed to editorial changes in the manuscript. All authors read and approved the final manuscript. All authors have participated sufficiently in the work and agreed to be accountable for all aspects of the work.
Not applicable.
Not applicable.
Xiamen medical and health guiding project [3502Z20224ZD1056] provided financial support for this study.
The authors declare no conflict of interest.
Publisher’s Note: IMR Press stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.