- Academic Editor
†These authors contributed equally.
Purpose: Numerous studies have emphasised the importance of necroptosis in the malignant progression of colorectal cancer (CRC). However, whether necroptosis-related genes (NRGs) can be used to predict the prognosis of CRC remains to be revealed. Methods: Patients with CRC were divided into two clusters based on the expression of NRGs, and prognosis was compared between the two clusters. A prognostic model was established based on NRGs, and its predictive efficiency was validated using Kaplan-Meier (K-M) curves, receiver operating characteristic (ROC) curves and a nomogram. Immune infiltration, single-cell and drug sensitivity analyses were used to examine the effects of NRGs on the prognosis of CRC. Results: The prognostic model served as a valid and independent predictor of CRC prognosis. Immune infiltration and single-cell analyses revealed that the unique immune microenvironment of CRC was regulated by NRGs. Drug sensitivity analysis showed that patients in the high- and low-risk groups were sensitive to different drugs. In addition, H2BC18 was found to play an important role in regulating the malignant progression of CRC. Conclusion: This study provides novel insights into precision immunotherapy based on NRGs in CRC. The NRG-based prognostic model may help to identify targeted drugs and develop more effective and individualised treatment strategies for patients with CRC.
Colorectal cancer (CRC) is a prevalent malignant gastrointestinal tumour worldwide. According to global cancer statistics, approximately 1.4 million new cases of CRC were reported in 2020, with CRC accounting for 9.4% of all cancer-related deaths [1]. Although remarkable advancements have been made in the prevention, screening and treatment of CRC in the past decade, the death rate of patients with CRC remains high [2], with the 5-year survival rate of patients with metastatic CRC being only 12% [3]. The main causes of recurrence and death in patients with CRC are local tumour infiltration, distant metastasis and resistance to existing therapies. Therefore, effective prognostic biomarkers should be identified and accurate prognostic models should be developed to reduce the risk of recurrence and death in patients with CRC. Necroptosis, first proposed by Degterev et al. [4] in 2005, is a novel cell death mechanism that relies on mixed lineage kinase domain-like proteins (MLKL/PMLKL) activated by receptor-interacting protein kinase-1/3 (RIPK1/RIPK3). Numerous studies have shown that necroptosis plays a crucial role in promoting and inhibiting cancer development [5, 6, 7]. However, to date, most studies on CRC have focused on the anti-tumour effects of typical necroptosis-related genes (NRGs) such as RIPK1/RIPK3 and MLKL/PMLKL. For example, Han et al. [8] found that resorcytoxin inhibited tumour growth by inducing necroptosis in CRC cells through an RIPK3-mediated mechanism and that GDC-0326 enhanced the anti-tumour effects of the chemotherapeutic drug 5-fluorouracil (5-Fu) by inducing necroptosis [9]. With regard to the tumour-specific effects of NRGs on CRC, Wang et al. [10] found that RIPK1, RIPK3 and MLKL genes were significantly upregulated and promoted the proliferation of cancer cells in mice with CRC treated with radiation therapy. Given that the role of necroptosis in CRC remains unclear, the effects of NRGs on the prognosis of CRC should be further investigated to elucidate the potential molecular mechanisms and regulatory networks.
In this study, we investigated differentially expressed NRGs between CRC and
adjacent normal tissues in The Cancer Genome Atlas (TCGA) datasets and identified
two molecular subtypes of CRC using unsupervised clustering. Subsequently, the
expression patterns of NRGs, enriched pathways, tumour microenvironment (TME)
characteristics and prognosis were compared between the two subtypes. A
prognostic risk model based on four NRGs, namely, GABPB1-IT1,
H2BC18, HSPA1L and MIR503HG, was constructed using
LASSO–Cox regression, and its predictive accuracy was evaluated using
Kaplan-Meier (K-M) curves, receiver operating characteristic (ROC) curves and a
nomogram. Immune infiltration analysis showed that the expression of the four
NRGs was markedly associated with the abundance of activated NK cells and CD4
We downloaded the RNA-sequencing and clinical data of 328 tissue samples,
including 40 adjacent normal tissues and 288 CRC tissues, from The Cancer Genome
Atlas (TCGA) database
(https://www.cancer.gov/ccg/research/genome-sequencing/tcga). The robust
multi-array averaging (RMA) algorithm in the ‘affy’ R package (version 1.46.1)
[11] was used to process these data. In addition, batch effects were removed
using the ‘sva’ R package (version 3.42.0) [12]. Differentially expressed genes
(DEGs) between CRC and normal tissues were identified using the ‘limma’ R package
(version 3.42.2) [13], with the screening criteria set as
The ‘ConensusClusterPlus’ R package (version 1.66.0) was used for consensus clustering analysis of NRGs [14]. Based on the expression of NRGs, two molecular subtypes were generated through K-means clustering. Gene set variation analysis (GSVA) was performed on gene sets extracted from MSigDB (C2.Cp.ke.v7.2) [15] to examine differences in biological functions between the two molecular subtypes.
We compared the prognosis and clinical features of patients with CRC between the two molecular subtypes. To compare overall survival (OS) between the two subtypes, Kaplan-Meier curves were generated using the ‘survival’ and ‘survminer’ R packages (version 4.2.3). The CIBERSORT algorithm was used to estimate the immune scores of 22 immune cell types in each CRC sample based on cell-specific gene signatures [16].
The ‘limma’ R package (version 3.42.2) was used to screen for DEGs between the
two molecular subtypes [13], with the screening criteria set as
The ‘RMS’ package (version 3.6.1) was used to establish a predictive nomogram based on NRG-Scores and clinical characteristics of CRC [19]. Column charts demonstrating NRG-Scores and predicted OS rates were generated, and calibration curves were plotted to compare the predicted and actual 1-, 3- and 5-year OS rates [20].
The infiltration levels of 22 types of immune cells were evaluated based on the expression of the four prognostic NRGs included in the risk model (model genes). A boxplot was generated to compare the expression of immune checkpoint genes between the low- and high-risk groups. In addition, drug sensitivity was compared between the two risk groups. The ‘pRRophetic’ package (version 4.3.2) was used to calculate the half-maximal inhibitory concentration (IC50) of targeted drugs to evaluate their clinical efficacy in the two risk groups [21].
The ‘Seurat’ package (version 5.0.1) was used to generate a Seurat object and
remove poor-quality cells. A standard procedure was used to pre-process the data,
and the percentages of gene count, cell count and mitochondrial content were
subsequently calculated. Cells with
The human CRC cell lines HCT116, HT29 and HCT15 and the normal human colorectal
epithelial cell line NCM460 were purchased from the Cell Center of the Institute
of Basic Medical Sciences, Chinese Academy of Medical Sciences. All cells were
cultured in DMEM (Gibco, New York, NY, USA) supplemented with 10% foetal bovine
serum (FBS) (VivaCell, Shanghai, China) and 1% penicillin-streptomycin (Gibco,
New York, NY, USA) in a humidified environment with 5% CO
siH2BC18-242 | AAGAUGUCGUUGACGAAGGAGTT |
siH2BC18-104 | UUCUUCUGCACUUUCGUAACATT |
siH2BC18-410 | UACUUCGAGCUGGUGUACUUGTT |
For quantitative reverse transcription polymerase chain reaction (qRT-PCR),
total RNA was extracted from CRC cells using Trizol reagent (Takara, Kyoto,
Japan) and was reverse transcribed using Prime Script RT Master Mix (Takara,
Kyoto, Japan). Quantitative PCR (qPCR) was performed using total 2 µL of mRNA,
specific primers and SYBR Premix Ex Taq II (Takara, Kyoto, Japan). The mRNA
expression of target genes was normalised to that of GAPDH (internal control) and
quantified using the 2
Gene | Forward (5 |
Reverse (5 |
CDKN2A | AGACTTTCGAAGAGGGGGAGCC | GCCCATCATCATGACCAGGAACA |
GABPB1-IT1 | AACCTGATTGGACTGTGGCG | GAGAGCAAAACAGTCCGGAGA |
H2BC18 | CCAAGTACACCAGCTCGAAGTTA | GTTGATGGGCAAGTGGGGTGA |
MIR503HG | AAGGAATCCTCTCCCACCATTT | ACTCATTTGGCGGGAAAAC |
GAPDH | CGGAGTCAACGGATTTGGTCGTAT | AGCCTTCTCCATGGTGG TGAAGAC |
qRT-PCR, quantitative reverse transcription polymerase chain reaction.
The cells were digested utilising 0.25% trypsin and centrifuged at a speed of
1200 rpm/min for 5 min. The supernatant was discarded, and the cell precipitate
was resuspended in 1 mL of a complete medium. Subsequently, the cells were
counted using a Bovine Bow counting plate (QiuJing, Shanghai, China) with a
filled cell. The cell suspension was diluted to a concentration of 1
Migration assay: Cells were cultured in a serum-free medium overnight. The
following day, the cells were digested using 0.25% trypsin and centrifuged at
1200 rpm/min for 5 min. The supernatant was discarded, and the cell precipitate
was washed thrice with PBS. The cells were resuspended in 1 mL of a basal medium
and counted on Oxbow counting plates. The concentration of HCT15 cells was
adjusted to 4
Invasion assay: The basal medium was used to dilute a substrate gel at a ratio of 1:8. A total of 60 µL of the diluted gel was added to the chambers, followed by incubation at 37 °C for 2 h. The subsequent steps were the same as those for the migration assay.
Wound healing assay: CRC cells were cultured in 6-well plates until
Total proteins were extracted from cells and CRC tissues using RIPA buffer (Solarbio, Beijing, China). The extracted proteins were quantified via BCA assay, separated on 8–12% sodium dodecyl sulphate–polyacrylamide gels and transferred to polyvinylidene difluoride membranes. The membranes were initially incubated with anti-H2BC18 (1:1000, Boiss, Beijing, China) and anti-GAPDH (1:5000, Bioworld, Nanjing, China) primary antibodies and subsequently incubated with horseradish peroxidase (HRP)-conjugated anti-rabbit IgG antibody (secondary antibody, 1:5000, Bioworld, Nanjing, China). Finally, protein bands were visualised using an ECL reagent (Bioworld, Nanjing, China).
The expression of H2BC18 in clinical tissues was assessed via
immunohistochemical (IHC) analysis using anti-H2BC18 antibody (1:500, Boiss,
Beijing, China), Paraffin-embedded tissue blocks were cut into
4-µm-thick sections, dewaxed, rehydrated using xylene I/II/III and
anhydrous ethanol I/II/III (absolute ethyl alcohol) for 15 minutes each and
washed with PBS two times for 5 minutes each. For antigen retrieval, tissue
slides were placed in a sectioning rack and slowly immersed into an antigen
repair solution. The solution was boiled on high for 5 min and on low for 20 min.
Subsequently, the sections were washed with PBS two times for 10 minutes each,
blocked with 3% bovine serum albumin (BSA) for 30 minutes at room temperature
and incubated with primary antibodies overnight at 4 °C in a humidified
incubator. The following day, the sections were washed with PBS (3
The R (version 4.2.0) software (New York, NY, USA) was used for statistical analysis and
visualisation of results. Student’s t-test was used to compare normally
distributed quantitative data and Wilcoxon test was used to compare non-normally
distributed quantitative data between groups. Statistical significance was
denoted as follows: *, p
The gene expression data of 328 tissue samples, including 40 adjacent normal tissues and 288 CRC tissues, were extracted from TCGA database. A total of 1831 DEGs were identified between CRC and adjacent normal tissues (Fig. 1A); of which, 945 genes were upregulated and 886 genes were downregulated (Fig. 1B). These DEGs were intersected with 160 NRGs obtained from the GeneCards database using a Venn diagram, and 18 differentially expressed NRGs associated with CRC were eventually obtained (Fig. 1C). Subsequently, a consensus clustering algorithm was used to classify patients with CRC based on the expression of the 18 NRGs. With the optimal k value of 2, the patients were divided into cluster A and cluster B (Fig. 1D). Clinical characteristics (Fig. 1E) and NRG function were compared between the two clusters using Kaplan-Meier (K-M) analysis, immune infiltration analysis and GSVA. K-M curves showed that patients in cluster B had shorter OS than patients in cluster A (Fig. 1F). GSVA showed that cluster A was enriched in pathways related to inhibition of tumour development, including type I interferon signalling pathway and activation of mitochondrial autophagy, whereas cluster B was significantly enriched in tumour-promoting pathways such as DNA replication and chromatin aggregation (Fig. 1G). The infiltration levels of 22 types of immune cells differed significantly between the two clusters, with the infiltration levels of activated CD4 T cells and type 2 T helper cells (Th2) being higher in cluster A than in cluster B (Fig. 1H). These results suggested that the two clusters had different TME-associated properties and NRGs prolonged the OS of patients in cluster A by promoting anti-tumour immunity.
Screening and categorisation of overall survival (OS)-related
necroptosis-related genes (NRGs) in colorectal cancer (CRC). (A) Heatmap showing
the top 60 differentially expressed genes (DEGs) (n = 1813) between CRC and
adjacent normal tissue samples. (B) Volcano plot showing up-regulated (n = 945)
and down-regulated genes (n = 886). (C) Venn diagram demonstrating the
intersection between DEGs and necroptosis-related genes (n = 160). (D) Consensus
matrix heatmap defining two clusters and associated regions. (E) Relationship of
clusters A and B with clinicopathologic features and NRGs. (F) Kaplan-Meier
curves (log-rank test, p
Although the two molecular subtypes of necroptosis were found to have different
prognostic and immune infiltration patterns, these findings are only applicable
to patient populations and are not accurate for assessing the impact of NRGs on
the prognosis of CRC. Therefore, we established a prognostic model based on the
differentially expressed NRGs between clusters A and B for diagnosing CRC and
guiding treatment. Briefly, we randomly divided patients with CRC into training
(n = 287) and test (n = 41) sets and identified four NRGs significantly
associated with CRC prognosis, namely, CABPB1-IT1,
H2BC18, HSPA1L and MIR503HG, via LASSO regression
analysis. The NRG-Score was calculated based on these four NRGs as follows:
GABPB1-IT1 expression level
Construction and evaluation of a prognostic model. (A) 1000-fold cross-validation for the selection of LASSO
regression variables. (B) LASSO regression coefficients of necroptosis-related
genes. Each curve corresponds to a gene involved in necroptosis. (C) Expression
of 18 OS-associated NRGs in the high- and low-risk groups. (D) Kaplan-Meier (K-M)
survival curves for the low- and high-risk groups in the training set. (E) K-M
survival curves for the low- and high-risk groups in the test set. (F) K-M
survival curves for the low- and high-risk groups in the total-sample dataset.
(G) Receiver operating characteristic (ROC) curves for predicting 1-, 3- and
5-year OS in the training set. (H) Receiver operating characteristic (ROC) curves
for predicting 1-, 3- and 5-year OS in the test set. (I) Receiver operating
characteristic (ROC) curves for predicting 1-, 3- and 5-year OS in the
total-sample dataset. (*, p
Development and validation of the nomogram. (A) Nomogram
integrating NRG-Scores and clinical characteristics such as age, sex, TNM and
stage for predicting 1-, 3- and 5-year OS. (B) Calibration curve demonstrating
the accuracy of the nomogram in predicting survival at 1, 3 and 5 years. The
dashed line represents the performance of an ideal nomogram, whereas the solid
green, blue and red lines indicate the performance of the established nomogram. **, p
Studies have shown that necroptosis can promote cell death by enhancing tumour
immunogenicity and that activation of the necroptotic factor RIPK1/RIPK3 can lead
to upregulation of inflammatory chemokines in the TME, promoting immune cell
activation [24, 25, 26]. Therefore, we investigated the association between the four
NRGs and immune cell infiltration using the CIBERSORT algorithm. The four NRGs
showed a significant correlation with most immune cells (Fig. 4A). In particular,
a negative correlation was observed between the expression of NRGs and the
infiltration levels of activated NK cells and CD4
Immune characterisation of prognostic NRGs in the CRC
microenvironment. (A) Correlation between the expression of the four NRGs and
the abundance of tumour-infiltrating immune cells. (B) Correlation between the
abundance of activated Nature Killer (NK) cells and NRG-Scores. (C) Correlation between the
abundance of CD4
To examine the ability of NRG-Scores to guide the clinical treatment of CRC, we assessed the sensitivity of patients in the high- and low-risk groups to potential targeted drugs. The results showed that patients in the low-risk group responded better to LCK inhibitors (Fig. 5A), third-generation AKT inhibitors (Fig. 5B), JNK inhibitors (Fig. 5C) and the third-generation ABL inhibitor ponatinib (Fig. 5D), whereas patients in the high-risk group responded better to oral PARP inhibitors (Fig. 5E). Altogether, these findings suggest that the abovementioned drugs have potential therapeutic value in the treatment of CRC.
Drug sensitivity analysis in the high- and low-risk groups. (A) Differences in the expression of LCK inhibitors between the high- and low-risk groups. (B) Differences in the expression of AKT inhibitors between the high- and low-risk groups. (C) Differences in the expression of JNK inhibitors between the high- and low-risk groups. (D) Differences in the expression of the third-generation ABL inhibitor ponatinib between the high- and low-risk groups. (E) Differences in the expression of PARP inhibitors between the high- and low-risk groups.
To assess the expression of prognosis-associated NRGs in the TME of CRC at the single-cell level, we extracted scRNA-sequencing data from the GSE4158911 and GSE4158912 datasets. After quality control and filtering, cells were classified as mast cells, fibroblasts, endothelial cells, epithelial cells and myeloid cells through dimensionality reduction (Fig. 6A,B). HSPA1L was highly expressed in fibroblasts and endothelial cells, whereas MIR503HG was highly expressed in epithelial cells. Given that CRC is a malignant tumour originating from epithelial cells, upregulated NRGs in epithelial cells may promote the transformation of normal epithelial cells to malignant tumour cells, suggesting that NRGs play an important role in the development of CRC (Fig. 6C).
Analysis of the expression of NRGs in cell clusters using scRNA-sequencing data. (A) Cell clusters annotated in the GSE4158911 dataset. (B) Cell clusters annotated in the GSE4158912 dataset. (C) Differential expression of two prognostically relevant NRGs in six cell clusters.
To verify the differential expression and molecular functions of NRGs in CRC, we assessed the mRNA expression of the four prognosis-related NRGs (GABPB1-IT1, H2BC18, HSPA1L and MIR503HG) in three CRC cell lines (HCT15, HCT116 and HT29) and a normal colorectal epithelial cell line (NCM460). The expression of GABPB1-IT1 (Fig. 7A), HSPA1L (Fig. 7B) and MIR503HG (Fig. 7C) was significantly lower in HCT15 and HCT116 cells than in NCM460 cells but was significantly higher in HT29 cells than in NCM460 cells. Only the expression of H2BC18 was significantly higher in all three CRC cell lines than in the normal control cell line (Fig. 7D). Consistently, western blotting showed that the protein expression of H2BC18 was significantly elevated in the three CRC cell lines (Fig. 7E). Clinical tissue samples, including 3 CRC and colorectal inflammation tissues, were collected to verify these results. Immunohistochemical (IHC) analysis showed that the protein expression of H2BC18 was higher in CRC tissues than in colorectal inflammation tissues (Fig. 7F). In addition, IHC data from the Human Protein Atls (HPA) database validated the differential expression of H2BC18 protein between CRC and colorectal inflammation tissues (Fig. 7G). Altogether, these results suggest that H2BC18 plays an important role as a prognosis-associated gene in CRC. Therefore, in subsequent experiments, we examined the biological function of H2BC18 in CRC progression.
Expression of prognosis-related NRGs in colorectal cancer (CRC) cell lines. (A)
Expression of GABPB1-IT1 in CRC cells versus NCM460
cells. (B) Expression of HSPA1L in CRC cells versus NCM460 cells. (C)
Expression of MIR503HG in CRC cells versus NCM460 cells. (D) Expression
of H2BC18 in CRC cells versus NCM460 cells (*, p
To assess the effects of H2BC18 on the malignant progression of CRC, HCT15 cells were transiently transfected with an siRNA targeting H2BC18. The proliferative, invasive and migratory abilities of CRC cells were examined after the successful knockdown of H2BC18 (Fig. 8A). CCK-8 assay showed that knockdown of H2BC18 inhibited the proliferation of HCT15 cells (Fig. 8B). In addition, wound healing and transwell invasion assays showed that knockdown of H2BC18 significantly inhibited the migratory and invasive abilities of HCT15 cells (Fig. 8B–D). Altogether, these results suggest that H2BC18 plays an important role in regulating the malignant progression of CRC.
H2BC18 regulates the proliferative, invasive and migratory
abilities of CRC cells. (A) Western blotting was performed to detect the
efficiency of H2BC18 knockdown in HCT15 cells. (B) CCK-8 assay was performed to
examine the proliferative ability (OD450) of CRC cells after H2BC18
knockdown. (C) Wound healing assay was performed to examine the migratory ability
of CRC cells after H2BC18 knockdown. (D) Transwell assay was performed
to examine the invasive and migratory abilities of CRC cells after
H2BC18 knockdown (*, p
CRC is one of the three most prevalent malignant tumours worldwide [27], with
the second-highest mortality rate [1]. Metastasis and the failure of early
diagnosis leading that the 5-year survival rate of patients with CRC is
We analysed the relationship between NRGs and CRC. In the TCGA dataset, NRGs
were found to be differentially expressed between CRC and normal adjacent tissues
and correlated with the prognosis of CRC. Two molecular subtypes were classified
based on the expression patterns of 18 NRGs. These subtypes showed significant
differences in prognosis, immune cell infiltration and molecular functions of
NRGs. In terms of prognosis, patients in cluster A had longer OS than those in
cluster B. In terms of immune infiltration, the abundance of CD4
Furthermore, we developed a prognostic risk model (NRG-Score) based on four differentially expressed prognosis-associated NRGs, namely, H2BC18, HSPA1L, MIR503HG and GABPB1-IT1. Subsequently, a nomogram integrating the NRG-Score and clinicopathologic features was established to predict the OS of patients with CRC. The calibration curve demonstrated that the nomogram had superior predictive performance, especially for long-term survival. Unlike in other studies [34], in this study, patients with CRC were divided into training, test and total-sample validation sets, and the predictive accuracy and validity of the prognostic model were verified by evaluating the AUC values of each group. Altogether, the results suggested that the prognostic model had better predictive accuracy. The four NRGs included in the model have been shown to play important roles in cancer [35, 36, 37, 38, 39, 40, 41, 42], suggesting that the NRG-Score developed in this study is closely related to the development and prognosis of CRC.
The TME is a complex ecosystem composed of many different cell populations, and its composition is closely related to the prognosis and treatment response of patients with CRC [43]. Many studies have reported that the OS and progression-free survival (PFS) of patients with CRC can be predicted based on the type, spatial location and infiltration levels of immune cells [44, 45, 46]. To examine the effects of the four prognostic NRGs on the immune microenvironment of CRC, patients were divided into high- and low-risk groups based on the median NRG-Score. The abundance of tumour-infiltrating immune cells in the TME, expression of immune checkpoint genes and sensitivity to targeted drugs were significantly different between the low- and high-risk groups.
The interaction between immune and cancer cells in the TME is important for tumour progression and drug resistance [47]. Therefore, we examined the association between the four NRGs and immune cell infiltration using the CIBERSORT algorithm. It was found that the expression of NRGs was significantly associated with the abundance of most immune cells. In particular, the expression of NRGs was negatively correlated with the abundance of NK cells and CD4+ memory T cells. NK cells perform multiple functions in the human body. Infiltration of NK cell indicates a better prognosis in gastric cancer and squamous cell carcinoma, suggesting that NK cells have anti-tumour activity [48]. CD4 T cells can kill tumour cells directly through anti-specific [49, 50] cytolytic mechanisms or indirectly by modulating the TME. These findings suggest that the low abundance of activated NK cells and CD4 memory T cells in the TME of patients in the high-risk group may lead to a worse prognosis. Single-cell analysis showed the significantly higher expression of HSPA1L and MIR503HG in epithelial cells, fibroblasts and endothelial cells, suggesting that these NRGs mediate the depletion of NK and CD4 memory T cells through epithelial cells and fibroblasts, thus contributing to the immunosuppressive microenvironment of CRC. In addition, most immune checkpoint genes (CD160, CD80, HHLA2 and CD244) were significantly lower in the high-risk group, suggesting that patients in this group may benefit more from immune checkpoint inhibitor therapy targeting these genes. In order to screen for potential targeted drugs for the treatment of CRC, Drug sensitivity analysis was performed to identify potential targeted drugs for the treatment of CRC. The results showed that patients in the low-risk group were more sensitive to LCK inhibitors, third-generation AKT inhibitors, JNK inhibitors and the third-generation ABL inhibitor ponatinib, whereas those in the high-risk group were more sensitive to oral PARP inhibitors, which are effective in inhibiting DNA repair in CRC cells [51, 52] and are currently used to improve radiosensitivity in clinical practice.
The expression of the four NRGs was evaluated in three CRC cell lines (HCT15, HCT116 and HT29). HSPA1L, MIR503HG and GABPB1-IT1 were differently expressed in the three cell lines. In particular, the expression of the three NRGs was low in HCT15 and HCT116 cells but high in HT29 cells. This differential expression may be related to the dual role of necroptosis in CRC and the heterogeneity among different CRC subtypes. On the contrary, the expression of H2BC18 was significantly elevated in all three cell lines, suggesting that H2BC18 plays an important role in regulating the development of CRC. The protein expression of H2BC18 in CRC cells and tissues was analysed via WB and IHC analysis and validated using IHC data from the HPA database. We found that the protein expression of H2BC18 was higher in CRC cells than in normal colon cells as well as in CRC tissues than in adjacent normal tissues. Finally, we preliminarily examined the biological functions of H2BC18 in the malignant progression of CRC. The invasive, migratory and proliferative abilities of HCT15 cells were significantly weaker in the H2BC18-knockdown group than in the control group, indicating that the NRG H2BC18 plays a more important regulatory role in the development of CRC.
In conclusion, we developed and validated the NRG-Score prognostic model and examined the potential biological effects of the NRGs included in this model on the immune microenvironment of CRC. The model accurately predicted the OS of patients with CRC and their sensitivity to common chemotherapeutic agents and improved individual prognostic monitoring. Therefore, the model may guide the development of novel NRG-targeted therapies for CRC.
In this study, we performed an in-depth analysis of the expression of NRGs in CRC and identified and characterised two molecular subtypes based on the expression patterns of NRGs. In addition, we established the NRG-Score and found that patients with CRC with low NRG-Scores had a better prognosis. On evaluating the available biomarkers that could be used for immunotherapy, we found that patients with high NRG-Scores might benefit more from immunotherapy. These findings improve our understanding of TME and immune cell infiltration in CRC and may guide the development of more effective immunotherapies and targeted therapies. However, this study has some limitations that should be acknowledged. First, elucidating the precise role of each NRG in CRC requires multi-omic data and an in-depth understanding of molecular mechanisms. Second, the four core NRGs warrant further validation in preclinical studies. Therefore, large-sample, prospective cohort studies as well as in vivo and in vitro experimental studies should be conducted to validate the predictive accuracy of the NRG-Score.
The datasets generated during the current study are available from the supplementary information or the corresponding author upon reasonable request. The datasets supporting the conclusions of this article are available in the The Cancer Genome Atlas (TCGA) database (https://www.cancer.gov/ccg/research/genome-sequencing/tcga), TCGA-CRC, GSE4158911, GSE4158912.
QL, ML, YH and LL conceived and coordinated the study. YH and LL wrote and revised the paper. YH, LL, ZK, HLuo, XL, SZ and QZ analysed the experiments. QL, ML and HLiu offered technical or material support for the experiments, critical reading, and text revisions. All authors contributed to editorial changes in the manuscript. All authors reviewed the results and approved the final version of the manuscript. All authors have participated sufficiently in the work and agreed to be accountable for all aspects of the work.
Not applicable.
We thank Bullet Edits Limited for the linguistic editing and proofreading of the manuscript.
The present study was supported by the National Natural Science Foundation of China (81960476, 81460365, 81760039, 82173378), Guizhou Provincial Science and Technology Projects ([2019]1270), Guizhou Provincial Health and Health Commission Fund (gzwkj2021-160), and Guizhou Medical University Science and Technology Projects (21NSFCP12).
The authors declare no conflict of interest.
Publisher’s Note: IMR Press stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.